PANK1 (NM_148978) Human Untagged Clone

CAT#: SC306350

PANK1 (untagged)-Human pantothenate kinase 1 (PANK1), transcript variant beta



  "NM_148978" in other vectors (4)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to PANK1 (pantothenate kinase 1)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PANK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306350 representing NM_148978.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTTATAAATGGCAAAAAGCAAACATTCCCATGGTTTGGCATGGACATCGGTGGAACGCTGGTT
AAATTGGTGTATTTCGAGCCGAAGGATATTACAGCCGAAGAGGAGCAAGAGGAAGTGGAGAACCTGAAG
AGCATCCGGAAGTATTTGACTTCTAATACTGCTTATGGGAAAACTGGGATCCGAGACGTCCACCTGGAA
CTGAAAAACCTGACCATGTGTGGACGCAAAGGGAACCTGCACTTCATCCGCTTTCCCAGCTGTGCTATG
CACAGGTTCATTCAGATGGGCAGCGAGAAGAACTTCTCTAGCCTTCACACCACCCTCTGTGCCACAGGA
GGCGGGGCTTTCAAATTCGAAGAGGACTTCAGAATGATTGCTGACCTGCAGCTGCATAAACTGGATGAA
CTGGACTGTCTGATTCAGGGCCTGCTTTATGTCGACTCTGTTGGCTTCAACGGCAAGCCAGAATGTTAC
TATTTTGAAAATCCCACAAATCCTGAATTGTGTCAAAAAAAGCCGTACTGCCTTGATAACCCATACCCT
ATGTTGCTGGTTAACATGGGCTCAGGTGTCAGCATTCTAGCCGTGTACTCCAAGGACAACTATAAAAGA
GTTACAGGGACCAGTCTTGGAGGTGGAACATTCCTAGGCCTATGTTGCTTGCTGACTGGTTGTGAGACC
TTTGAAGAAGCTCTGGAAATGGCAGCTAAAGGCGACAGCACCAATGTTGATAAACTGGTGAAGGACATT
TACGGAGGAGACTATGAACGATTTGGCCTTCAAGGATCTGCTGTAGCATCAAGCTTTGGCAACATGATG
AGTAAAGAAAAGCGAGATTCCATCAGCAAGGAAGACCTCGCCCGGGCCACATTGGTCACCATCACCAAC
AACATTGGCTCCATTGCTCGGATGTGCGCGTTGAATGAGAACATAGACAGAGTTGTGTTTGTTGGAAAT
TTTCTCAGAATCAATATGGTCTCCATGAAGCTGCTGGCATATGCCATGGATTTTTGGTCCAAAGGACAA
CTGAAAGCTCTGTTTTTGGAACATGAGGGTTATTTTGGAGCCGTTGGGGCACTGTTGGAACTGTTCAAA
ATGACTGATGACAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_148978
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_148978.2
RefSeq Size 6198 bp
RefSeq ORF 1122 bp
Locus ID 53354
UniProt ID Q8TE04
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis
MW 41.7 kDa
Gene Summary This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (beta) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant alpha. The encoded isoform (beta) has a distinct N-terminus and is shorter than isoform alpha. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...