United States
Germany
Japan
United Kingdom
China
TNFRSF18 (NM_148902) Human Untagged Clone
CAT＃: SC306329
TNFRSF18 (untagged)-Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AITR; CD357; ENERGEN; GITR; GITR-D |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_148902, the custom clone sequence may differ by one or more nucleotides
ATGGCACAGCACGGGGCGATGGGCGCGTTTCGGGCCCTGTGCGGCCTGGCGCTGCTGTGC GCGCTCAGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCCCTGGGCGCCTCCTG CTTGGGACGGGAACGGACGCGCGCTGCTGCCGGGTTCACACGACGCGCTGCTGCCGCGAT TACCCGGGCGAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGCCTGAATTCCAC TGCGGAGACCCTTGCTGCACGACCTGCCGGCACCACCCTTGTCCCCCAGGCCAGGGGGTA CAGTCCCAGGGGAAATTCAGTTTTGGCTTCCAGTGTATCGACTGTGCCTCGGGGACCTTC TCCGGGGGCCACGAAGGCCACTGCAAACCTTGGACAGACTGCACCCAGTTCGGGTTTCTC ACTGTGTTCCCTGGGAACAAGACCCACAACGCTGTGTGCGTCCCAGGGTCCCCGCCGGCA GAGCCGCTTGGGTGGCTGACCGTCGTCCTCCTGGCCGTGGCCGCCTGCGTCCTCCTCCTG ACCTCGGCCCAGCTTGGACTGCACATCTGGCAGCTGAGGAAGACCCAGCTGCTGCTGGAG GTGCCGCCGTCGACCGAAGACGCCAGAAGCTGCCAGTTCCCCGAGGAAGAGCGGGGCGAG CGATCGGCAGAGGAGAAGGGGCGGCTGGGAGACCTGTGGGTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_148902 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_148902.1, NP_683700.1 |
| RefSeq Size | 1193 bp |
| RefSeq ORF | 705 bp |
| Locus ID | 8784 |
| UniProt ID | Q9Y5U5 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (3) contains an extra coding segment, which leads to a frame shift, compared to variant 2. The resulting protein (isoform 3) contains a distinct and shorter C-terminus, as compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220671 | TNFRSF18 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 3 |
CNY 3,990.00 |
|
| RC220671L3 | Lenti-ORF clone of TNFRSF18 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 3 |
CNY 5,890.00 |
|
| RC220671L4 | Lenti-ORF clone of TNFRSF18 (mGFP-tagged)-Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 3 |
CNY 5,890.00 |
|
| RG220671 | TNFRSF18 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), transcript variant 3 |
CNY 4,240.00 |
其它TNFRSF18产品
