HFE (NM_139007) Human Untagged Clone
CAT#: SC306102
HFE (untagged)-Human hemochromatosis (HFE), transcript variant 7
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HFE1; HH; HLA-H; MVCD7; TFQTL2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_139007, the custom clone sequence may differ by one or more nucleotides
ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTG CAGGGGCGCTTGCTGCAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAA GACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTC TGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAG TGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCT GCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGTGCCTCCT TTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTACGGTGTCGGGCCTTG AACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAGCAGCCAATGGATGCC AAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACCTACCAGGGCTGGATA ACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAGGTGGAGCACCCAGGC CTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCTGGCACCCTAGTCATTGGA GTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATTGGAATTTTGTTCATAATA TTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTACGTCTTAGCTGAACGTGAG TGA |
Restriction Sites | Please inquire |
ACCN | NM_139007 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_139007.1, NP_620576.1 |
RefSeq Size | 1085 bp |
RefSeq ORF | 783 bp |
Locus ID | 3077 |
UniProt ID | Q30201 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) lacks an internal in-frame segment of the coding region, as compared to variant 1, resulting in a shorter protein isoform (7). CCDS Note: This CCDS ID represents a variant of the HFE gene that lacks an internal coding exon compared to the longest variant, which is represented by CCDS4578.1. This results in an isoform that includes the Immunoglobulin constant region (IGc) domain but lacks a portion of the Class I Histocompatibility antigen (MHC_I) domain. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217560 | HFE (Myc-DDK-tagged)-Human hemochromatosis (HFE), transcript variant 7 |
CNY 3,990.00 |
|
RC217560L3 | Lenti-ORF clone of HFE (Myc-DDK-tagged)-Human hemochromatosis (HFE), transcript variant 7 |
CNY 5,890.00 |
|
RC217560L4 | Lenti-ORF clone of HFE (mGFP-tagged)-Human hemochromatosis (HFE), transcript variant 7 |
CNY 5,890.00 |
|
RG217560 | HFE (tGFP-tagged) - Human hemochromatosis (HFE), transcript variant 7 |
CNY 4,370.00 |