United States
Germany
Japan
United Kingdom
China
IL17E (IL25) (NM_022789) Human Untagged Clone
CAT＃: SC305051
IL25 (untagged)-Human interleukin 25 (IL25), transcript variant 1
CNY 2,400.00
CNY 3,990.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL17E |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_022789 edited
GGGAGGCCAAGCTGCCAGGTTTGGGGCTGGGGGCCAAGTGGAGTGAGAAACTGGGATCCC AGGGGGAGGGTGCAGATGAGGGAGCGACCCAGATTAGGTGAGGACAGTTCTCTCATTAGC CTTTTCCTACAGGTGGTTGCATTCTTGGCAATGGTCATGGGAACCCACACCTACAGCCAC TGGCCCAGCTGCTGCCCCAGCAAAGGGCAGGACACCTCTGAGGAGCTGCTGAGGTGGAGC ACTGTGCCTGTGCCTCCCCTAGAGCCTGCTAGGCCCAACCGCCACCCAGAGTCCTGTAGG GCCAGTGAAGATGGACCCCTCAACAGCAGGGCCATCTCCCCCTGGAGATATGAGTTGGAC AGAGACTTGAACCGGCTCCCCCAGGACCTGTACCACGCCCGTTGCCTGTGCCCGCACTGC GTCAGCCTACAGACAGGCTCCCACATGGACCCCCGGGGCAACTCGGAGCTGCTCTACCAC AACCAGACTGTCTTCTACAGGCGGCCATGCCATGGCGAGAAGGGCACCCACAAGGGCTAC TGCCTGGAGCGCAGGCTGTACCGTGTTTCCTTAGCTTGTGTGTGTGTGCGGCCCCGTGTG ATGGGCTAGCCGGACCTGCTGGAGGCTGGTCCCTTTTTGGGAAACCTGGAGCCAGGTGTA CAACCACTTGCCATGAAGGGCCAGGATGCCCAGATGCTTGGCCCCTGTGAAGTGCTGTCT GGAGCAGCAGGATCCCGGGACAGGATGGGGGGCTTTGGGGAAAACCTGCACTTCTGCACA TTTTGAAAAGAGCAGCTGCTGCTTAGGGCCGCCGGAAGCTGGTGTCCTGTCATTTTCTCT CAGGAAAGGTTTTCAAAGTTCTGCCCATTTCTGGAGGCCACCACTCCTGTCTCTTCC |
| Restriction Sites | Please inquire |
| ACCN | NM_022789 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a good match to NM_022789.2 except for one SNP. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_022789.2, NP_073626.1 |
| RefSeq Size | 1387 bp |
| RefSeq ORF | 534 bp |
| Locus ID | 64806 |
| UniProt ID | Q9H293 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes a longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A functional DC cross talk promotes human ILC homeostasis in humanized mice
,Lopez-Lastra, S;Masse-Ranson, G;Fiquet, O;Darche, S;Serafini, N;Li, Y;Dusséaux, M;Strick-Marchand, H;Santo, JP;,
Blood Advances
[IL25]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210141 | IL25 (Myc-DDK-tagged)-Human interleukin 25 (IL25), transcript variant 1 |
CNY 3,600.00 |
|
| RC210141L1 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC210141L2 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC210141L3 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC210141L4 | Lenti ORF clone of Human interleukin 25 (IL25), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
| RG210141 | IL25 (tGFP-tagged) - Human interleukin 25 (IL25), transcript variant 1 |
CNY 5,200.00 |
