United States
Germany
Japan
United Kingdom
China
KLRC3 (NM_007333) Human Untagged Clone
CAT＃: SC303911
KLRC3 (untagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NKG2-E; NKG2E |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303911 representing NM_007333.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGTGGCAGCAAAGGAAA CCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTCCAAGTAGAATTAAACCTTCAA AATGCTTCTCTGAATCATCAAGGGATTGATAAAATATATGACTGCCAAGGTTTACTGCCACCTCCAGAA AAGCTCACTGCCGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTT CTTATTCCTTTCCTGGAGCAGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGC CATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGG GAAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATGAAGAAGAA ATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCA TGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATCATGCTGAACGTAACTGT GCAATGCTACATGTACGTGGACTTATATCAGACCAGTGTGGATCTTCAAGAATCATTGTGAGCATAAGC TTTAGAATTAAAGCGCTTGAGCTTGCAGTGCATCAGATAAAATTTTATATTTGTTCAAACAGAAATGAT ATTATGATTGCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_007333 |
| Insert Size | 774 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_007333.2 |
| RefSeq Size | 843 bp |
| RefSeq ORF | 774 bp |
| Locus ID | 3823 |
| UniProt ID | Q07444 |
| Protein Families | Transmembrane |
| Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
| MW | 29 kDa |
| Gene Summary | Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as NKG2-H, uses an alternate splice site and lacks an exon in the 3' coding region, compared to variant 1. The resulting protein (isoform H) contains a distinct C-terminus, compared to isoform E. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220268 | KLRC3 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2 |
CNY 2,400.00 |
|
| RC220268L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220268L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG220268 | KLRC3 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2 |
CNY 4,370.00 |
