United States
Germany
Japan
United Kingdom
China
QK1 (QKI) (NM_006775) Human Untagged Clone
CAT＃: SC303824
QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Hqk; hqkI; QK; QK1; QK3 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_006775 edited
ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAG CTGATGAACGACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCAC CTCGAGCGGCTGCTGGACGAAGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACA TTAAATGGCAGTACAGAGAAAAGGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTT CAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGG AGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAA ATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGC AAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCT CAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTA CCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTG AATGGCACCTACAGAGATGCCAACATTAAATCACCAGCCCTTGCCTTTTCTCTTGCAGCA ACAGCCCAGGCTGCTCCAAGGATCATTACTGGGCCTGCGCCGGTTCTCCCACCAGCTGCC CTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACAAATACAGACC GCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCTCCAGGGCCCGAA GCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCAATC CTTGAGTATCCTATTGAACCTAGTGGTGTATTAGGTGCGGTGGCTACTAAAGTTCGAAGG CACGATATGCGTGTCCATCCTTACCAAAGGATTGTGACCGCAGACCGAGCCGCCACCGGC AACTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006775 |
| Insert Size | 2000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006775.1, NP_006766.1 |
| RefSeq Size | 4731 bp |
| RefSeq ORF | 1026 bp |
| Locus ID | 9444 |
| UniProt ID | Q96PU8 |
| Gene Summary | The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) encodes the longest isoform (1; also known as HQK-5 and QKI-5). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205779 | QKI (Myc-DDK-tagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1 |
CNY 3,656.00 |
|
| RC205779L1 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205779L2 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC205779L3 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205779L4 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG205779 | QKI (tGFP-tagged) - Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 1 |
CNY 4,370.00 |
