United States
Germany
Japan
United Kingdom
China
PTPN7 (NM_002832) Human Untagged Clone
CAT＃: SC303244
PTPN7 (untagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BPTP-4; HEPTP; LC-PTP; LPTP; PTPNI |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002832 edited
ATGGTCGGGAAGGCCTGGCCCCTCACCCATTCCCAGGGAACGGGGCCTTGGGCCCCAGAA GGGCACAGGCGGGAGGCAGCCGACCCCTGGTGGCAGCGGCAGCAGGCACAGGAGGGCAGA ATGCAGCTGGGGTGTGCGTGGGTGGCAGCAAGGAGGGGCGGAGGGAGGAAGCTGGCTTCC TGGAGCCTTCTCAGCCCTCAAAGACAGACCGACAGACAGACAGACAGCTGGCAAGAGGCA GCCTGGGGGCCACAGCTGCTTCAGCAGACCTCATGGCTGAGTGAGCCTCCCCTGGGCCCA GCACCCCACCTCAGCATGGTCCAAGCCCATGGGGGGCGCTCCAGAGCACAGCCGTTGACC TTGTCTTTGGGGGCAGCCATGACCCAGCCTCCGCCTGAAAAAACGCCAGCCAAGAAGCAT GTGCGACTGCAGGAGAGGCGGGGCTCCAATGTGGCTCTGATGCTGGACGTTCGGTCCCTG GGGGCCGTAGAACCCATCTGCTCTGTGAACACACCCCGGGAGGTCACCCTACACTTTCTG CGCACTGCTGGACACCCCCTTACCCGCTGGGCCCTTCAGCGCCAGCCACCCAGCCCCAAG CAACTGGAAGAAGAATTCTTGAAGATCCCTTCAAACTTTGTCAGCCCCGAAGACCTGGAC ATCCCTGGCCACGCCTCCAAGGACCGATACAAGACCATCTTGCCAAATCCCCAGAGCCGT GTCTGTCTAGGCCGGGCACAGAGCCAGGAGGACGGAGATTACATCAATGCCAACTACATC CGAGGCTATGACGGGAAGGAGAAGGTCTACATTGCCACCCAGGGCCCCATGCCCAACACT GTGTCGGACTTCTGGGAGATGGTGTGGCAAGAGGAAGTGTCCCTCATTGTCATGCTCACT CAGCTCCGAGAGGGCAAGGAGAAATGTGTCCACTACTGGCCCACAGAAGAGGAAACCTAT GGACCCTTCCAGATCCGCATCCAGGACATGAAAGAGTGCCCAGAATACACTGTGCGGCAG CTCACCATCCAGTACCAGGAAGAGCGCCGGTCAGTAAAGCACATCCTCTTTTCGGCCTGG CCAGACCATCAGACACCAGAATCAGCTGGGCCCCTGCTGCGCCTAGTGGCAGAGGTGGAG GAGAGCCCGGAGACAGCCGCCCACCCCGGGCCTATCGTAGTCCACTGCAGTGCAGGGATT GGCCGGACGGGCTGCTTCATCGCCACGCGAATTGGCTGTCAACAGCTGAAAGCCCGAGGA GAAGTGGACATTCTGGGTATTGTGTGCCAACTGCGGCTAGACAGAGGGGGGATGATCCAG ACGGCAGAGCAGTACCAGTTCCTGCACCACACTTTGGCCCTGTATGCAGGCCAGCTGCCT GAGGAACCCAGCCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_002832 |
| Insert Size | 3100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002832.2, NP_002823.2 |
| RefSeq Size | 2805 bp |
| RefSeq ORF | 1083 bp |
| Locus ID | 5778 |
| UniProt ID | P35236 |
| Protein Families | Druggable Genome, Phosphatase |
| Protein Pathways | MAPK signaling pathway |
| Gene Summary | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This gene is preferentially expressed in a variety of hematopoietic cells, and is an early response gene in lymphokine stimulated cells. The non-catalytic N-terminus of this PTP can interact with MAP kinases and suppress the MAP kinase activities. This PTP was shown to be involved in the regulation of T cell antigen receptor (TCR) signaling, which was thought to function through dephosphorylating the molecules related to MAP kinase pathway. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200699 | PTPN7 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 5,856.00 |
|
| RC200699L1 | Lenti-ORF clone of PTPN7 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 8,256.00 |
|
| RC200699L2 | Lenti-ORF clone of PTPN7 (mGFP-tagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 5,890.00 |
|
| RC200699L3 | Lenti-ORF clone of PTPN7 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 5,890.00 |
|
| RC200699L4 | Lenti-ORF clone of PTPN7 (mGFP-tagged)-Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 5,890.00 |
|
| RG200699 | PTPN7 (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 1 |
CNY 7,456.00 |
