United States
Germany
Japan
United Kingdom
China
DEFB110 (NM_001037497) Human Untagged Clone
CAT＃: SC302901
DEFB110 (untagged)-Human defensin, beta 110 locus (DEFB110), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DEFB-10; DEFB-11; DEFB111 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302901 representing NM_001037497.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGATTCAACTTTTTTTCTTTATTCTGCACTTTTGGGTCACAATTTTACCAGCCAAAAAGAAATAT CCTGAGTATGGTAGCTTGGACTTGAGGAGAGAGTGCAGAATAGGTAATGGTCAATGTAAAAATCAGTGT CATGAAAATGAAATTAGGATTGCTTACTGCATAAGACCTGGAACTCATTGCTGCTTGCAGCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001037497 |
| Insert Size | 204 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001037497.1 |
| RefSeq Size | 400 bp |
| RefSeq ORF | 204 bp |
| Locus ID | 245913 |
| UniProt ID | Q30KQ9 |
| Protein Families | Secreted Protein |
| MW | 8 kDa |
| Gene Summary | Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a, also known as DEFB111). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213753 | DEFB110 (Myc-DDK-tagged)-Human defensin, beta 110 locus (DEFB110), transcript variant 1 |
CNY 1,200.00 |
|
| RC213753L3 | Lenti ORF clone of Human defensin, beta 110 locus (DEFB110), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213753L4 | Lenti ORF clone of Human defensin, beta 110 locus (DEFB110), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG213753 | DEFB110 (tGFP-tagged) - Human defensin, beta 110 locus (DEFB110), transcript variant 1 |
CNY 4,370.00 |
其它DEFB110产品
