LAT (NM_001014988) Human Untagged Clone

CAT#: SC301978

LAT (untagged)-Human linker for activation of T cells (LAT), transcript variant 3



  "NM_001014988" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


LAT rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IMD52; LAT1; pp36
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301978 representing NM_001014988.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGGCCATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATG
GCACTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTGTATCCA
AGGGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTACCCACCTGTCACCTCC
TACCCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCATCCCCGCAGCCCCTTGGGGGCTCCCACCGG
ACGCCATCTTCCCGGCGGGATTCTGATGGTGCCAACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCC
TGTGAGGATGCGGATGAGGATGAGGACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGC
ACCCCGGCCACTAGCACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCC
TTCTCCATGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCTCTG
GATGGCAGCCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAGACTGAGCCTGCC
GCCCTGAGTTCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCAGATTACGAGAATCTGCAGGAG
CTGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001014988
Insert Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001014988.1
RefSeq Size 1677 bp
RefSeq ORF 699 bp
Locus ID 27040
UniProt ID O43561
Protein Families Druggable Genome, Transmembrane
Protein Pathways Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway
MW 24.8 kDa
Gene Summary The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 4. The resulting isoform (c) is shorter at the N- terminus and lacks an internal aa compared to isoform d.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...