MPST (NM_001013436) Human Untagged Clone

CAT#: SC301784

MPST (untagged)-Human mercaptopyruvate sulfurtransferase (MPST), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_001013436" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MPST Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MST; TST2; TUM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301784 representing NM_001013436.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCGCCGCAGCTCTGCCGCGCGCTGGTGTCGGCGCAATGGGTGGCGGAGGCGCTGCGGGCCCCG
CGCGCTGGGCAGCCTCTGCAGCTGCTGGACGCCTCCTGGTACCTGCCGAAGCTGGGGCGCGACGCGCGA
CGCGAGTTCGAGGAGCGCCACATCCCGGGCGCCGCTTTCTTCGACATCGACCAGTGCAGCGACCGCACC
TCGCCCTACGACCACATGCTGCCCGGGGCCGAGCATTTCGCGGAGTACGCAGGCCGCCTGGGCGTGGGC
GCGGCCACCCACGTCGTGATCTACGACGCCAGCGACCAGGGCCTCTACTCCGCCCCGCGCGTCTGGTGG
ATGTTCCGCGCCTTCGGCCACCACGCCGTGTCACTGCTTGATGGCGGCCTCCGCCACTGGCTGCGCCAG
AACCTCCCGCTCAGCTCCGGCAAGAGCCAACCTGCTCCCGCCGAGTTCCGCGCTCAGCTCGACCCCGCC
TTCATCAAGACCTACGAGGACATCAAGGAGAACCTGGAATCCCGGCGCTTCCAGGTGGTGGACTCCCGA
GCCACTGGCAGGTTCCGCGGCACCGAGCCCGAGCCCCGAGACGGCATTGAACCTGGCCACATCCCAGGT
ACCGTGAACATCCCCTTCACAGACTTCCTGAGCCAGGAGGGGCTGGAGAAGAGCCCTGAGGAGATCCGC
CATCTGTTCCAGGAGAAGAAAGTGGACCTGTCTAAGCCACTGGTGGCCACGTGTGGCTCTGGCGTCACA
GCCTGCCACGTGGCACTAGGGGCCTACCTCTGCGGCAAGCCAGACGTGCCCATCTACGATGGCTCCTGG
GTGGAGTGGTACATGCGCGCCCGGCCCGAGGATGTCATCTCAGAGGGCCGGGGGAAGACCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001013436
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001013436.2
RefSeq Size 1371 bp
RefSeq ORF 894 bp
Locus ID 4357
UniProt ID P25325
Protein Families Druggable Genome
Protein Pathways Cysteine and methionine metabolism, Metabolic pathways
MW 33.2 kDa
Gene Summary This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate donor splice site at the first exon compared to variant 1, resulting in translation initiation from a downstream AUG, and an isoform (2) with a shorter N-terminus compared to isoform 1. Transcript variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...