United States
Germany
Japan
United Kingdom
China
GOSR1 (NM_001007024) Human Untagged Clone
CAT＃: SC301133
GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301133 representing NM_001007024.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGCTTACAGGGGTAAATGATAAAATG GCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGAATGCAGCCCTGATGCATACATTACAGCGGCAT AGAGACATATTGCAGGATTATACACATGAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAA AGGGAGAATCTTATGGGATCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAAC AGAAGAACTGAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACA ATAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAATTCACAGC AAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGAGGATCAACCTGAGGAAG CGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTACCATCCTGTTGCTGCTGTATGCGTTC CATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001007024 |
| Insert Size | 558 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001007024.1 |
| RefSeq Size | 5246 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 9527 |
| UniProt ID | O95249 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | SNARE interactions in vesicular transport |
| MW | 21.2 kDa |
| Gene Summary | This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has an additional segment in one exon and lacks a small segment in another exon in the 5' region, as compared to variant 1. It uses a downstream AUG start codon, and the encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214955 | GOSR1 (Myc-DDK-tagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3 |
CNY 2,400.00 |
|
| RC214955L3 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC214955L4 | Lenti ORF clone of Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG214955 | GOSR1 (tGFP-tagged) - Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3 |
CNY 4,370.00 |
