OR13C9 (NM_001001956) Human Untagged Clone

CAT#: SC300360

OR13C9 (untagged)-Human olfactory receptor, family 13, subfamily C, member 9 (OR13C9)



  "NM_001001956" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal anti-OR13C9 antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OR9-13; OR37L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC300360 representing NM_001001956.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAATGGGAAAACCAAACCATTCTGGTGGAATTTTTTCTGAAGGGACATTCTGTTCACCCAAGGCTT
GAGTTACTCTTTTTTGTGCTAATCTTCATAATGTATGTGGTCATCCTTCTGGGGAATGGTACTCTCATT
TTAATCAGCATCTTGGACCCTCACCTTCACACCCCTATGTACTTCTTTCTGGGGAACCTCTCCTTCTTG
GACATCTGCTACACCACCACCTCTATTCCCTCCACACTAGTGAGCTTCCTTTCAGAAAGAAAGACCATT
TCCTTTTCTGGCTGTGCAGTGCAGATGTTCCTTGGCTTGGCCATGGGGACAACAGAGTGTGTGCTTCTG
GGCATGATGGCCTTTGACCGCTATGTGGCTATCTGCAACCCTCTGAGATATCCCATCATCATGAGCAAG
AATGCCTATGTACCCATGGCTGTTGGGTCCTGGTTTGCAGGGATTGTCAACTCTGCAGTACAAACTACA
TTTGTAGTACAATTGCCTTTCTGCAGGAAGAATGTCATCAATCATTTCTCATGTGAAATTCTAGCTGTC
ATGAAGTTGGCCTGTGCTGACATCTCAGGCAATGAGTTCCTCATGCTTGTGGCCACAATATTGTTCACA
TTGATGCCACTGCTCTTGATAGTTATCTCTTACTCATTAATCATTTCCAGCATCCTCAAGATTCACTCC
TCTGAGGGGAGAAGCAAAGCTTTCTCTACCTGCTCAGCCCATCTGACTGTGGTCATAATATTCTATGGG
ACCATCCTCTTCATGTATATGAAGCCCAAGTCTAAAGAGACACTTAATTCAGATGACTTGGATGCTACC
GACAAAATTATATCCATGTTCTATGGGGTGATGACTCCCATGATGAATCCTTTAATCTACAGTCTTAGA
AACAAGGATGTGAAAGAGGCAGTAAAACACCTACCGAACAGAAGGTTCTTTAGCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001001956
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001956.1
RefSeq Size 957 bp
RefSeq ORF 957 bp
Locus ID 286362
UniProt ID Q8NGT0
Protein Families Transmembrane
Protein Pathways Olfactory transduction
MW 35.9 kDa
Gene Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...