RPS28 (NM_001031) Human Untagged Clone

CAT#: SC127600

RPS28 (untagged)-Human ribosomal protein S28 (RPS28)



  "NM_001031" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPS28 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA15; eS28; S28
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC127600 sequence for NM_001031 edited (data generated by NextGen Sequencing)
ATGGACACCAGCCGTGTGCAGCCTATCAAGCTGGCCAGGGTCACCAAGGTCCTGGGCAGG
ACCGGTTCTCAGGGACAGTGCACGCAGGTGCGCGTGGAATTCATGGACGACACGAGCCGA
TCCATCATCCGCAATGTAAAAGGCCCCGTGCGCGAGGGCGACGTGCTCACCCTTTTGGAG
TCAGAGCGAGAAGCCCGGAGGTTGCGCTGA

Clone variation with respect to NM_001031.4
>OriGene 5' read for NM_001031 unedited
CGGCCGCGAATTCGGCACCAGGCCGCGCCGCCATCATGGACACCAGCCGTGTGCAGCCTA
TCAAGCTGGCCAGGGTCACCAAGGTCCTGGGCAGGACCGGTTCTCAGGGACAGTGCACGC
AGGTGCGCGTGGAATTCATGGACGACACGAGCCGATCCATCATCCGCAATGTAAAAGGCC
CCGTGCGCGAGGGCGACGTGCTCACCCTTTTGGAGTCAGAGCGAGAAGCCCGGAGGTTGC
GCTGAGCTTGGCTGCTCGCTGGGTCTTGGATGTCGGGTTCGACCACTTGGCCGATGGGAA
TGGTCTGTCACAATCTGCTCCTTTTTTTTGTCCGCCACACGTAACTGAGATGCTCCTTTA
ATAAAGCGTTTGTGTTTCANGTTNANAAAAANNAANNAAAAAAAAAAAAAAAANCCTCGA
CTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGT
GACCCCTCCCCAGTGCCTCTCCCTGCCCTGGGAAGTTGCCACTCCAGTGCCCCACCACCC
TTTGTCCTAATAAAATTAAGTTGCATCATTTTTGTCTGACCTAGGGGTCCCTTTATAATA
ATATGGGGTGAGGGGGGGGGGTGTTTTTGAGAAAAAGGGGGCCAAATTTTGGAAAAAACA
CCTTGTAAGGGCCTGGCGGGGGTCATTTGGGAACCAAGCTTGGGAGCGCAGGGGCACAAT
CTGGGCTTACTGC
Restriction Sites NotI-NotI     
ACCN NM_001031
Insert Size 310 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001031.3, NP_001022.1
RefSeq Size 1269 bp
RefSeq ORF 210 bp
Locus ID 6234
UniProt ID P62857
Domains Ribosomal_S28e
Protein Pathways Ribosome
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S28E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...