RPL11 (NM_000975) Human Untagged Clone

CAT#: SC126938

RPL11 (untagged)-Human ribosomal protein L11 (RPL11), transcript variant 1



  "NM_000975" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RPL11 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA7; GIG34; L11; uL5
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC126938 sequence for NM_000975 edited (data generated by NextGen Sequencing)
ATGGCGCAGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTC
TGTCTCAACATCTGTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTG
GAGCAGCTCACAGGGCAGACCCCTGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTT
GGCATCCGGAGAAATGAAAAGATTGCTGTCCACTGCACAGTTCGAGGGGCCAAGGCAGAA
GAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAGTTAAGAAAAAACAACTTCTCA
GATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGTATCAAATATGAC
CCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGC
ATCGCAGACAAGAAGCGCAGGACAGGCTGCATTGGGGCCAAACACAGAATCAGCAAAGAG
GAGGCCATGCGCTGGTTCCAGCAGAAGTATGATGGGATCATCCTTCCTGGCAAATAA

Clone variation with respect to NM_000975.3
>OriGene 5' read for NM_000975 unedited
ATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGC
GGCCGCGAATTCGGCACGAGGCTCCATCATGGCGCAGGATCAAGGTGAAAAGGAGAACCC
CATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATCTGTGTTGGGGAGAGTGGAGA
CAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACCCCTGTGTTTTC
CAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTCCA
CTGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGA
GTATGAGTTAAGAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGA
ACACATCGATCTGGGTATCAAATATGACCCAAGCATTGGTATCTACGGCCTGNACTTCTA
TGTGGTGCTGGGTAGGCCAGGTTTCAGCATCGCAGACAAGAAGCGCAGGACAGGCTGCAT
TGNGGCCAAACACAGAATCAGCAAAGAGGAAGCCATGCGCTGGTTCCAGCAGAAGTATGA
TGGGATCATCCTTCCTGGNCAAATAATTCCCGTTTCTATC
Restriction Sites NotI-NotI     
ACCN NM_000975
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000975.2, NP_000966.2
RefSeq Size 609 bp
RefSeq ORF 537 bp
Locus ID 6135
UniProt ID P62913
Domains Ribosomal_L5
Protein Pathways Ribosome
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...