Estrogen Receptor 1 (ESR1) (NM_000125) Human Untagged Clone
CAT#: SC125287
ESR1 (untagged)-Human estrogen receptor 1 (ESR1), transcript variant 1
CNY 6,656.00
Cited in 9 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ER; Era; ESR; ESRA; ESTRR; NR3A1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC125287 sequence for NM_000125 edited (data generated by NextGen Sequencing)
ATGACCATGACCCTCCACACCAAAGCATCTGGGATGGCCCTACTGCATCAGATCCAAGGG AACGAGCTGGAGCCCCTGAACCGTCCGCAGCTCAAGATCCCCCTGGAGCGGCCCCTGGGC GAGGTGTACCTGGACAGCAGCAAGCCCGCCGTGTACAACTACCCCGAGGGCGCCGCCTAC GAGTTCAACGCCGCGGCCGCCGCCAACGCGCAGGTCTACGGTCAGACCGGCCTCCCCTAC GGCCCCGGGTCTGAGGCTGCGGCGTTCGGCTCCAACGGCCTGGGGGGTTTCCCCCCACTC AACAGCGTGTCTCCGAGCCCGCTGATGCTACTGCACCCGCCGCCGCAGCTGTCGCCTTTC CTGCAGCCCCACGGCCAGCAGGTGCCCTACTACCTGGAGAACGAGCCCAGCGGCTACACG GTGCGCGAGGCCGGCCCGCCGGCATTCTACAGGCCAAATTCAGATAATCGACGCCAGGGT GGCAGAGAAAGATTGGCCAGTACCAATGACAAGGGAAGTATGGCTATGGAATCTGCCAAG GAGACTCGCTACTGTGCAGTGTGCAATGACTATGCTTCAGGCTACCATTATGGAGTCTGG TCCTGTGAGGGCTGCAAGGCCTTCTTCAAGAGAAGTATTCAAGGACATAACGACTATATG TGTCCAGCCACCAACCAGTGCACCATTGATAAAAACAGGAGGAAGAGCTGCCAGGCCTGC CGGCTCCGCAAATGCTACGAAGTGGGAATGATGAAAGGTGGGATACGAAAAGACCGAAGA GGAGGGAGAATGTTGAAACACAAGCGCCAGAGAGATGATGGGGAGGGCAGGGGTGAAGTG GGGTCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGC TCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTG GATGCTGAGCCCCCGATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCT TCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGG GCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAA TGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTG AAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGC ATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTG CAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACA TTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGAC AAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAG CACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAA GGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTG CTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTG GAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAA AAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACGGTCTGA Clone variation with respect to NM_000125.3 975 c=>g;1199 g=>t |
Restriction Sites | Please inquire |
ACCN | NM_000125 |
Insert Size | 3500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000125.2, NP_000116.2 |
RefSeq Size | 6456 bp |
RefSeq ORF | 1788 bp |
Locus ID | 2099 |
UniProt ID | P03372 |
Domains | HOLI, Oest_recep, zf-C4 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | This gene encodes an estrogen receptor and ligand-activated transcription factor. The canonical protein contains an N-terminal ligand-independent transactivation domain, a central DNA binding domain, a hinge domain, and a C-terminal ligand-dependent transactivation domain. The protein localizes to the nucleus where it may form either a homodimer or a heterodimer with estrogen receptor 2. The protein encoded by this gene regulates the transcription of many estrogen-inducible genes that play a role in growth, metabolism, sexual development, gestation, and other reproductive functions and is expressed in many non-reproductive tissues. The receptor encoded by this gene plays a key role in breast cancer, endometrial cancer, and osteoporosis. This gene is reported to have dozens of transcript variants due to the use of alternate promoters and alternative splicing, however, the full-length nature of many of these variants remain uncertain. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (1) uses the most proximal promoter, and encodes isoform 1. Variants 1-4 all encode the same isoform 1. |
Citations (9)
The use of this cDNA Clones has been cited in the following citations: |
---|
Genetic variation in the farnesoid X-receptor predicts Crohn\'s disease severity in female patients
,Wilson, A;Wang, Q;Almousa, AA;Jansen, LE;Choi, YH;Schwarz, UI;Kim, RB;,
Sci Rep
,PubMed ID 32678214
[ESR1]
|
Estrogen receptor α (ERα) indirectly induces transcription of human renal organic anion transporter 1 (OAT1)
,Euteneuer, AM;Seeger-Nukpezah, T;Nolte, H;Henjakovic, M;,
Physiol Rep
,PubMed ID 31724834
[ESR1]
|
Estrogen receptor α drives pro-resilient transcription in mouse models of depression
,Lorsch, ZS;Loh, YE;Purushothaman, I;Walker, DM;Parise, EM;Salery, M;Cahill, ME;Hodes, GE;Pfau, ML;Kronman, H;Hamilton, PJ;Issler, O;Labonté, B;Symonds, AE;Zucker, M;Zhang, TY;Meaney, MJ;Russo, SJ;Shen, L;Bagot, RC;Nestler, EJ;,
Nat Commun
,PubMed ID 29549264
[ESR1]
|
Oestrogens Downregulate Tissue Factor Pathway Inhibitor through Oestrogen Response Elements in the 5'-Flanking Region
,Ali, HO;Stavik, B;Myklebust, CF;Andersen, E;Dahm, AE;Iversen, N;Sandset, PM;Skretting, G;,
PLoS ONE
,PubMed ID 26999742
[ESR1]
|
The estrogen receptor ? colocalizes with proopiomelanocortin in hypothalamic neurons and binds to a conserved motif present in the neuron-specific enhancer nPE2
,null,
European journal of pharmacology
,PubMed ID 21211522
[ESR1]
|
The Role of miR-206 in the Epidermal Growth Factor (EGF) Induced Repression of Estrogen Receptor- (ER) Signaling and a Luminal Phenotype in MCF-7 Breast Cancer Cells
,Brian D. Adams, Danielle M. Cowee, and Bruce A. White,
Mol. Endocrinol., Aug 2009; 23: 1215 - 1230.
[ESR1]
|
The Role of miR-206 in The Epidermal Growth Factor (EGF) Induced Repression of Estrogen Receptor-alpha (ER) Signaling and a Luminal Phenotype in MCF-7 Breast Cancer Cells
,Brian D. Adams, Danielle M. Cowee, and Bruce A. White,
Mol. Endocrinol., May 2009; 10.1210/me.2009-0062.
[ESR1]
|
Dosage-Sensitive Sex Reversal Adrenal Hypoplasia Congenita Critical Region on the X Chromosome, Gene 1 (DAX1) (NR0B1) and Small Heterodimer Partner (SHP) (NR0B2) Form Homodimers Individually, as Well as DAX1-SHP Heterodimers
,Anita K. Iyer, Yao-Hua Zhang, and Edward R. B. McCabe,
Mol. Endocrinol. 2006 Oct;20(10):2326-42.
[ESR1]
|
Naloxone acts as an antagonist of estrogen receptor activity in MCF-7 cells
,Mariya Farooqui, Zhen H. Geng, Elliot J. Stephenson, Nurulain Zaveri, Douglas Yee, and Kalpna Gupta,
Mol. Cancer Ther. 2006 Mar;5(3):611-20.
[ESR1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213277 | ESR1 (Myc-DDK-tagged)-Human estrogen receptor 1 (ESR1), transcript variant 1 |
CNY 6,648.00 |
|
RC213277L1 | Lenti ORF clone of Human estrogen receptor 1 (ESR1), transcript variant 1, Myc-DDK-tagged |
CNY 9,048.00 |
|
RC213277L2 | Lenti ORF clone of Human estrogen receptor 1 (ESR1), transcript variant 1, mGFP tagged |
CNY 9,048.00 |
|
RC213277L3 | Lenti ORF clone of Human estrogen receptor 1 (ESR1), transcript variant 1, Myc-DDK-tagged |
CNY 9,048.00 |
|
RC213277L4 | Lenti ORF clone of Human estrogen receptor 1 (ESR1), transcript variant 1, mGFP tagged |
CNY 9,048.00 |
|
RG213277 | ESR1 (tGFP-tagged) - Human estrogen receptor 1 (ESR1), transcript variant 1 |
CNY 4,370.00 |
其它Estrogen Receptor 1产品