RPL35A (NM_000996) Human Untagged Clone

CAT#: SC119503

RPL35A (untagged)-Human ribosomal protein L35a (RPL35A)



  "NM_000996" in other vectors (4)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPL35A rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DBA5; eL33; L35A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC119503 sequence for NM_000996 edited (data generated by NextGen Sequencing)
ATGTCTGGAAGGCTGTGGTCCAAGGCCATTTTTGCTGGCTATAAGCGGGGTCTCCGGAAC
CAAAGGGAGCACACAGCTCTTCTTAAAATTGAAGGTGTTTACGCCCGAGATGAAACAGAA
TTCTATTTGGGCAAGAGATGCGCTTATGTATATAAAGCAAAGAACAACACAGTCACTCCT
GGCGGCAAACCAAACAAAACCAGAGTCATCTGGGGAAAAGTAACTCGGGCCCATGGAAAC
AGTGGCATGGTTCGTGCCAAATTCCGAAGCAATCTTCCTGCTAAGGCCATTGGACACAGA
ATCCGAGTGATGCTGTACCCCTCAAGGATTTAA

Clone variation with respect to NM_000996.2
>OriGene 5' read for NM_000996 unedited
TGTAATACGAACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTTGGCTCCTGTGGA
GGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGAAGGCTGTGGTCCAAGGCC
ATTTTTGCTGGCTATAAGCGGGGTCTCCGGAACCAAAGGGAGCACACAGCTCTTCTTAAA
ATTGAAGGTGTTTACGCCCGAGATGAAACAGAATTCTATTTGGGCAAGAGATGCGCTTAT
GTATATAAAGCAAAGAACAACACAGTCACTCCTGGCGGCAAACCAAACAAAACCAGAGTC
ATCTGGGGAAAAGTAACTCGGGCCCATGGAAACAGTGGCATGGTTCGTGCCAAATTCCGA
AGCAATCTTCCTGCTAAGGCCATTGGACACAGAATCCGAGTGATGCTGTACCCCTCAAGG
ATTTAAACTAACGAAAAATCAATAAATAAATGTGGATTTGTGCTCTTGTATTTTTAAGTG
GATTAAAAAACTTACTACCTTAAATTGATTTGCTACATGCTTAAAATGATAGAGGTTGCT
CAGCATTTTTGGAGTACAAGGGGGTCAGAGAGACATGTGATGAAAATTANCAGGGCGAGT
ACAGAGATTTAGAAGGGCAAACGGGTTTTAATGGCGAGTATCTTTNGACAGAGTCTTGCT
CTGTTGCCCATCTGGANTGTTNNAAGGGGTGCTCGCTGCAGCCTACATTCAAAGGCTCAA
GCAATCCTCCCTTGGCTTTTGAAGNTAGCTGGGAACACAGGCTCATGCACCATNCCTTGG
GNTATTTNTAAAATTCTGTNNAAAAAAGAGGGTCTGACTCTTGCCTATGCTGCTTNCAAC
TGCTGGCTCAGCAAATCTCTTCTTGCTTNCCTGAAAGGGCTGGGGAAAAAATTATGACCA
CAACCTGCAGGGGGTTTGGATCTATGCATTGTCAAGGCGATGC
Restriction Sites NotI-NotI     
ACCN NM_000996
Insert Size 1240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000996.2, NP_000987.2
RefSeq Size 511 bp
RefSeq ORF 333 bp
Locus ID 6165
UniProt ID P18077
Domains Ribosomal_L35Ae
Protein Pathways Ribosome
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L35AE family of ribosomal proteins. It is located in the cytoplasm. The rat protein has been shown to bind to both initiator and elongator tRNAs, and thus, it is located at the P site, or P and A sites, of the ribosome. Although this gene was originally mapped to chromosome 18, it has been established that it is located at 3q29-qter. Alternative splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...