GATA1 (NM_002049) Human Untagged Clone
CAT#: SC118871
GATA1 (untagged)- Human GATA binding protein 1 (globin transcription factor 1), 10ug
CNY 3,656.00
CNY 6,650.00
Cited in 3 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ERYF1; GATA-1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002049 edited
ATGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGAT CCTGCTCTGGTGTCCTCCACACCAGAATCAGGGGTTTTCTTCCCCTCTGGGCCTGAGGGC TTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTGCAGCTGCGGCACTG GCCTACTACAGGGACGCTGAGGCCTACAGACACTCCCCAGTCTTTCAGGTGTACCCATTG CTCAACTGTATGGAGGGGATCCCAGGGGGCTCACCATATGCCGGCTGGGCCTACGGCAAG ACGGGGCTCTACCCTGCCTCAACTGTGTGTCCCACCCGCGAGGACTCTCCTCCCCAGGCC GTGGAAGATCTGGATGGAAAAGGCAGCACCAGCTTCCTGGAGACTTTGAAGACAGAGCGG CTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAAT AGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTC AATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAG GCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACA GGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCC CTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAAC TGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAAT GCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCGGCCACTGACCATGCGGAAGGAT GGTATTCAGACTCGAAACCGCAAGGCATCTGGAAAAGGGAAAAAGAAACGGGGCTCCAGT CTGGGAGGCACAGGAGCAGCCGAAGGACCAGCTGGTGGCTTTATGGTGGTGGCTGGGGGC AGCGGTAGCGGGAATTGTGGGGAGGTGGCTTCAGGCCTGACACTGGGCCCCCCAGGTACT GCCCATCTCTACCAAGGCCTGGGCCCTGTGGTGCTGTCAGGGCCTGTTAGCCACCTCATG CCTTTCCCTGGACCCCTACTGGGCTCACCCACGGGCTCCTTCCCCACAGGCCCCATGCCC CCCACCACCAGCACTACTGTGGTGGCTCCGCTCAGCTCATGA |
Restriction Sites | Please inquire |
ACCN | NM_002049 |
Insert Size | 1700 bp |
OTI Disclaimer | The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required. |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain 15bp insertion compared with NM_002049.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002049.2, NP_002040.1 |
RefSeq Size | 1522 bp |
RefSeq ORF | 1242 bp |
Locus ID | 2623 |
UniProt ID | P15976 |
Domains | GATA |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008] |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Synovial GATA1 mediates rheumatoid arthritis progression via transcriptional activation of NOS2 signaling
,Liu, H;Wei, SP;Zhi, LQ;Liu, LP;Cao, TP;Wang, SZ;Chen, QP;Liu, D;,
Microbiol. Immunol.
,PubMed ID 29993142
[GATA1]
|
Transcription Factors with Conserved Binding Sites Near ATOH1 on the POU4F3 Gene Enhance the Induction of Cochlear Hair Cells
,Ikeda, R;Pak, K;Chavez, E;Ryan, AF;,
Mol. Neurobiol. July 2014
,PubMed ID 25015561
[GATA1]
|
PDSM, a motif for phosphorylation-dependent SUMO modification
,Ville Hietakangas, Julius Anckar, Henri A. Blomster, Mitsuaki Fujimoto, Jorma J. Palvimo, Akira Nakai, and Lea Sistonen,
Proc Natl Acad Sci U S A. 2006 Jan 3;103(1):45-50.
[GATA1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224854 | GATA1 (Myc-DDK-tagged)-Human GATA binding protein 1 (globin transcription factor 1) (GATA1) |
CNY 3,656.00 |
|
RC224854L1 | Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC224854L2 | Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), mGFP tagged |
CNY 5,890.00 |
|
RC224854L3 | Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224854L4 | Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), mGFP tagged |
CNY 5,890.00 |
|
RG224854 | GATA1 (tGFP-tagged) - Human GATA binding protein 1 (globin transcription factor 1) (GATA1) |
CNY 4,370.00 |