United States
Germany
Japan
United Kingdom
China
BEX2 (NM_032621) Human Untagged Clone
CAT＃: SC104136
BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BEX1; DJ79P11.1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_032621 edited
CCCGGTGTCCCTGAGGACGTGCGGGCCAGGTACGGCCCCGAAAGTAGGAAGCGGAGGGGG AGCAGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAATCGGGAGGAGG AGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCGTTAAACAATC TCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAGCAAGTTGCTA ATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTGCCTAGAGGAA ACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGACATAATGCATA GGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATTGGGGAGGAGG TGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTGCGGGCAGTCA GCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGA TGGTTTCCCTGAAGTTAATAGGGAGACCCCTGCTTCCTAAACTTACACATTTGTGGTGTA CCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGGTCTCCTATTACCAGCTTCT AAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAGTTTTACCTAT TGCATGGAAAGATGCTCATTATATATTGTGAAGTTAATAAAACAGTTTTAAAAAGCAAAA AAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_032621 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032621.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_032621.2, NP_116010.1 |
| RefSeq Size | 878 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 84707 |
| UniProt ID | Q9BXY8 |
| Domains | BEX |
| Gene Summary | This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same isoform (3). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202129 | BEX2 (Myc-DDK-tagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
CNY 1,200.00 |
|
| RC202129L3 | Lenti ORF clone of Human brain expressed X-linked 2 (BEX2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202129L4 | Lenti ORF clone of Human brain expressed X-linked 2 (BEX2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG202129 | BEX2 (tGFP-tagged) - Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
CNY 4,370.00 |
|
| SC322445 | BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3 |
CNY 1,200.00 |
