Ccl27a (NM_001048179) Mouse Tagged ORF Clone
CAT#: MR219818
- TrueORF®
Ccl27a (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 27A (Ccl27a), transcript variant 1
ORF Plasmid: tGFP
"NM_001048179" in other vectors (3)
Need custom modification / cloning service?
Get a free quote
CNY 1,200.00
CNY 3,705.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | ALP; AW558992; Ccl27; CTACK; CTAK; ESkine; ILC; PESKY; Scya27; Scya27a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR219818 representing NM_001048179
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGCGATTGAGGAGATACGAGGTGGCGCTGGAAGCGGAGGAGGAGATCTACTGGGGCTGCTTCTACT TTTTTCCTTGGCTGCGAATGTGGCGCAGGGAGCGGAGTCCGATGTCTCCAACAAGCCAGAGACTAAGTCT GGAAGCCCCCAGCCTCCCACTGAGAAGCTGGCATCCGTGGAACAAGACTAAGCAGAAGCAAGAAGCCTTG CCTCTGCCCTCCAGCACTAGCTGCTGTACTCAGCTCTATAGACAGCCACTCCCAAGCAGGCTGCTGAGGA GGATTGTCCACATGGAACTGCAGGAGGCCGATGGGGACTGTCACCTCCAGGCTGTCGTGCTTCACCTGGC TCGGCGCAGTGTCTGTGTTCATCCCCAGAACCGCAGCCTGGCTCGGTGGTTAGAACGCCAAGGGAAAAGG CTCCAAGGGACTGTACCCAGTTTAAATCTGGTACTACAAAAGAAAATGTACTCAAACCCCCAACAGCAAA AC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_001048179 |
ORF Size | 492 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001048179.2 |
RefSeq Size | 594 bp |
RefSeq ORF | 495 bp |
Locus ID | 20301 |
MW | 19.9 kDa |
Gene Summary | Chemotactic factor that attracts skin-associated memory T-lymphocytes. May play a role in mediating homing of lymphocytes to cutaneous sites. May play a role in cell migration during embryogenesis. Nuclear forms may facilitate cellular migration by inducing cytoskeletal relaxation. Binds to CCR10.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219818 | Ccl27a (tGFP-tagged) - Mouse chemokine (C-C motif) ligand 27A (Ccl27a) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR219818L3 | Lenti ORF clone of Ccl27a (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 27A (Ccl27a), transcript variant 1 |
CNY 4,750.00 |
|
MR219818L4 | Lenti ORF clone of Ccl27a (mGFP-tagged) - Mouse chemokine (C-C motif) ligand 27A (Ccl27a), transcript variant 1 |
CNY 4,750.00 |