Ackr3 (NM_001271607) Mouse Untagged Clone

CAT#: MC227283

Ackr3 (untagged) - Mouse atypical chemokine receptor 3 (Ackr3), transcript variant 1



  "NM_001271607" in other vectors (1)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW541270; Cmkor1; CXC-R7; CXCR-7; Cxcr7; RDC-1; Rdc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227283 representing NM_001271607
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGTGCACTTGTTTGACTATGCAGAGCCTGGCAACTACTCTGACATCAACTGGCCATGTAACAGCA
GCGACTGCATTGTGGTGGACACTGTGCAGTGTCCCACCATGCCTAACAAGAACGTGCTTCTGTATACCCT
CTCCTTCATCTACATTTTCATCTTCGTGATCGGCATGATTGCCAACTCTGTGGTGGTCTGGGTGAATATC
CAGGCTAAGACCACAGGCTACGACACGCACTGCTACATCTTGAACCTGGCCATTGCAGACCTGTGGGTCG
TCATCACCATCCCCGTCTGGGTGGTCAGTCTCGTGCAGCATAACCAGTGGCCCATGGGGGAGCTCACATG
CAAGATCACACACCTCATTTTCTCCATCAACCTCTTTGGGAGCATCTTCTTCCTCGCCTGCATGAGCGTG
GACCGCTATCTCTCCATCACCTACTTCACCGGCACCTCCAGCTATAAGAAGAAGATGGTACGCCGTGTTG
TATGCATCTTGGTGTGGCTGCTGGCCTTCTTTGTGTCCCTGCCTGATACCTACTACCTGAAGACGGTCAC
ATCTGCTTCCAACAATGAGACCTACTGCAGGTCCTTCTACCCCGAGCACAGCATCAAGGAGTGGCTGATC
GGCATGGAGCTGGTCTCTGTCATCTTGGGCTTTGCTGTCCCCTTCACTATCATTGCGATCTTCTACTTCC
TGCTCGCTAGAGCCATGTCAGCATCAGGCGACCAGGAGAAGCACAGTAGCCGGAAGATCATCTTCTCCTA
CGTGGTGGTCTTCCTGGTATGTTGGCTGCCGTACCATTTTGTGGTTCTGCTGGACATCTTCTCCATCTTA
CACTACATCCCGTTTACCTGTCAGCTGGAGAATGTGCTCTTTACAGCGTTGCATGTCACCCAGTGCCTGT
CCTTGGTGCACTGCTGTGTCAACCCCGTGCTCTACAGCTTCATCAACCGCAACTACAGGTACGAGCTGAT
GAAGGCCTTCATCTTCAAGTACTCGGCCAAAACAGGTCTCACCAAGCTCATTGATGCCTCCAGAGTGTCA
GAGACAGAGTACTCTGCCCTGGAACAGAACACCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271607
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271607.1, NP_001258536.1
RefSeq Size 2321 bp
RefSeq ORF 1089 bp
Locus ID 12778
UniProt ID P56485
Gene Summary Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Acts as a receptor for chemokines CXCL11 and CXCL12/SDF1. Chemokine binding does not activate G-protein-mediated signal transduction but instead induces beta-arrestin recruitment, leading to ligand internalization and activation of MAPK signaling pathway. Required for regulation of CXCR4 protein levels in migrating interneurons, thereby adapting their chemokine responsiveness. In glioma cells, transduces signals via MEK/ERK pathway, mediating resistance to apoptosis. Promotes cell growth and survival. Not involved in cell migration, adhesion or proliferation of normal hematopoietic progenitors but activated by CXCL11 in malignant hemapoietic cells, leading to phosphorylation of ERK1/2 (MAPK3/MAPK1) and enhanced cell adhesion and migration. Plays a regulatory role in CXCR4-mediated activation of cell surface integrins by CXCL12. Required for heart valve development.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...