Smox (NM_001177840) Mouse Untagged Clone

CAT#: MC212827

Smox (untagged) - Mouse spermine oxidase (Smox), transcript variant 9, (10ug)



  "NM_001177840" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms B130066H01Rik; PAO; PAOh1; SMO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212827 representing NM_001177840
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAAGTTGTGAATCCAGTGGCGACAGTGCGGATGACCCTCTCAGTCGTGGCCTACGGAGAAGGGGAC
AGCCTCGTGTGGTGGTGATCGGTGCTGGCTTGGCTGGCCTGGCTGCAGCTAGAGCCCTTCTGGAGCAGGG
CTTCACGGATGTCACTGTGCTTGAGGCTTCCAGCCACATTGGGGGCCGTGTGCAGAGTGTGAGGCTTGGA
GACACCACCTTTGAGCTGGGAGCCACCTGGATCCATGGATCCCACGGGAATCCTATCTATCAACTAGCAG
AAGCCAATGGCCTTTTGGAAGAGACAACAGATGGGGAGCGCAGTGTGGGCCGCATCAGCCTTTACTCCAA
GAATGGCGTGGCCTGCTACCTTACCAACCGTGGCTGCCGCATCCCCAAGGACGTGGTTGAGGAATTCAGC
GATTTATACAACGAGCCCATGCAGGTGCTCTTCTCCGGGGAGGCCACACACCGCAAGTACTACTCCACCA
CCCACGGTGCTCTGCTCTCTGGCCAGCGCGAGGCCGCCCGGCTCATCGAGATGTACCGAGACCTCTTCCA
GCAGGGGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177840
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177840.1, NP_001171311.1
RefSeq Size 1095 bp
RefSeq ORF 573 bp
Locus ID 228608
UniProt ID Q99K82
Gene Summary Flavoenzyme which catalyzes the oxidation of spermine to spermidine. Can also use N(1)-acetylspermine and spermidine as substrates, with different affinity depending on the isoform (isozyme) and on the experimental conditions. Plays an important role in the regulation of polyamine intracellular concentration and has the potential to act as a determinant of cellular sensitivity to the antitumor polyamine analogs. May contribute to beta-alanine production via aldehyde dehydrogenase conversion of 3-amino-propanal.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (9) lacks four alternate exons but maintains the reading frame, compared to variant 1. The resulting protein (isoform i) is shorter when it is compared to isoform a. This transcript has also been called 'splice variant delta'.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...