Cd247 (NM_001113391) Mouse Untagged Clone
CAT#: MC207245
Cd247 (untagged) - Mouse CD247 antigen (Cd247), transcript variant zeta, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4930549J05Rik; A430104F18Rik; AW552088; Cd3; Cd3-eta; Cd3-zeta; Cd3h; Cd3z; Cd3zeta; T3z; Tcrk |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207245 representing NM_001113391
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGTGGAAAGTGTCTGTTCTCGCCTGCATCCTCCACGTGCGGTTCCCAGGAGCAGAGGCACAGAGCT TTGGTCTGCTGGATCCCAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGGAGTCATCATCAC AGCCCTGTACCTGAGAGCAAAATTCAGCAGGAGTGCAGAGACTGCTGCCAACCTGCAGGACCCCAACCAG CTCTACAATGAGCTCAATCTAGGGCGAAGAGAGGAATATGACGTCTTGGAGAAGAAGCGGGCTCGGGATC CAGAGATGGGAGGCAAACAGCAGAGGAGGAGGAACCCCCAGGAAGGCGTATACAATGCACTGCAGAAAGA CAAGATGGCAGAAGCCTACAGTGAGATCGGCACAAAAGGCGAGAGGCGGAGAGGCAAGGGGCACGATGGC CTTTACCAGGGTCTCAGCACTGCCACCAAGGACACCTATGATGCCCTGCATATGCAGACCCTGGCCCCTC GCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001113391 |
Insert Size | 495 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001113391.2, NP_001106862.1 |
RefSeq Size | 1686 bp |
RefSeq ORF | 495 bp |
Locus ID | 12503 |
UniProt ID | P24161 |
Gene Summary | Part of the TCR-CD3 complex present on T-lymphocyte cell surface that plays an essential role in adaptive immune response. When antigen presenting cells (APCs) activate T-cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane by the CD3 chains CD3D, CD3E, CD3G and CD3Z. All CD3 chains contain immunoreceptor tyrosine-based activation motifs (ITAMs) in their cytoplasmic domain. Upon TCR engagement, these motifs become phosphorylated by Src family protein tyrosine kinases LCK and FYN, resulting in the activation of downstream signaling pathways. CD3Z ITAMs phosphorylation creates multiple docking sites for the protein kinase ZAP70 leading to ZAP70 phosphorylation and its conversion into a catalytically active enzyme. Plays an important role in intrathymic T-cell differentiation. Additionally, participates in the activity-dependent synapse formation of retinal ganglion cells (RGCs) in both the retina and dorsal lateral geniculate nucleus (dLGN).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (zeta) encodes the shortest isoform (zeta). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201306 | Cd247 (Myc-DDK-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta |
CNY 1,200.00 |
|
MR201306L3 | Lenti ORF clone of Cd247 (Myc-DDK-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta |
CNY 4,750.00 |
|
MR201306L4 | Lenti ORF clone of Cd247 (mGFP-tagged) - Mouse CD247 antigen (Cd247), transcript variant zeta |
CNY 4,750.00 |