CPNE1 (NM_152930) Human 3' UTR Clone

CAT#: SC202490

3' UTR clone of copine I (CPNE1) transcript variant 7 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CPNE1 (NM_152930) Human 3' UTR Clone
Vector pMirTarget
Synonyms copine-1; copine I; COPN1; CPN1; MGC1142; OTTHUMP00000030775; OTTHUMP00000030776
ACCN NM_152930
Insert Size 245 bp
Sequence Data
>SC202490 3’UTR clone of NM_152930
The sequence shown below is from the reference sequence of NM_152930. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGATCCTGCACAGGCCCCCCAGGCCTAGGTTCCCTTGGAGGCTGTGGCAAGTCCTCAATCCTGTGTC
CCAGAGGTCCCTCTGGGCCACAACCCAACCCTTCTCACTCTCCTCAGTGCTAGCACTTTGTATTTTTTG
ATACTTTTATACTTGTTTCTGCTTTTGCTGCTCTTGATCCCACCTTTGCTCCTGACAACCCTCATTCAA
TAAAGACCAGTGAAGACCAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152930.1
Synonyms copine-1; copine I; COPN1; CPN1; MGC1142; OTTHUMP00000030775; OTTHUMP00000030776
Summary Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a calcium-dependent protein that also contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. However, the encoded protein does not contain a predicted signal sequence or transmembrane domains. This protein has a broad tissue distribution and it may function in membrane trafficking. This gene and the gene for RNA binding motif protein 12 overlap at map location 20q11.21. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Aug 2008]
Locus ID 8904
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...