Apg3 (ATG3) (NM_001278712) Human Untagged Clone

CAT#: SC335263

ATG3 (untagged) - Human autophagy related 3 (ATG3), transcript variant 2



  "NM_001278712" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ATG3 mouse monoclonal antibody, clone OTI2C12 (formerly 2C12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APG3; APG3-LIKE; APG3L; PC3-96
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335263 representing NM_001278712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGAATGTGATTAATACTGTGAAGGGAAAGGCACTGGAAGTGGCTGAGTACCTGACCCCGGTCCTC
AAGGAATCAAAGTTTAAGGAAACAGGTGTAATTACCCCAGAAGAGTTTGTGGCAGCTGGAGATCACCTA
GTCCACCACTGTCCAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATACCTACCAACA
GGCAAACAATTTTTGGTAACCAAAAATGTGCCGTGCTATAAGCGGTGCAAACAGATGGAATATTCAGAT
GAATTGGAAGCTATCATTGAAGAAGATGATGGTGATGGCGGATGGGTAGATACATATCACAACACAGGT
ATTACAGGAATAACGGAAGCCGTTAAAGAGATCACACTGGAAAATAAGGACAATATAAGGCTTCAAGAT
TGCTCAGCACTATGTGAAGAGGAAGAAGATGAAGATGAAGGAGAAGCTGCAGATATGGAAGAATATGAA
GAGAGTGGATTGTTGGAAACAGATGAGGCTACCCTAGATACAAGGAAAATAGTAGAAGCTTGTAAAGCC
AAAACTGATGCTGGCGGTGAAGATGCTATTTTGCAAACCAGAACTTATGACCTTTACATCACTTATGAT
AAATATTACCAGACTCCACGATTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAG
CACATGTATGAAGACATCAGTCAGGATCATGTGAAGAAAACAGTGACCATTGAAAATCACCCTCATCTG
CCACCACCTCCCATGTGTTCAGTTCACCCATGCAGGCATGCTGAGGTGATGAAGAAAATCATTGAGACT
GTTGCAGAAGGAGGGGGAGAACTTGGAGTTCATATGTATCCTTCCCTGTATGTAAGATTAGTGGCAAAA
TGGCTGTTAACGATTTTTTTTTTGAGAAATTTAGTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278712
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278712.1
RefSeq Size 3060 bp
RefSeq ORF 936 bp
Locus ID 64422
UniProt ID Q9NT62
Protein Pathways Regulation of autophagy
MW 35.5 kDa
Gene Summary This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) contains a 3' terminal exon that extends past a splice site that is used in variant 1 that results in an early stop codon and a different 3' UTR, compared to variant 1. It encodes a protein which is shorter at the C-terminus (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...