GANC (NM_001301410) Human Untagged Clone

CAT#: SC335051

GANC (untagged) - Human glucosidase, alpha, neutral C (GANC), transcript variant 3



  "NM_001301410" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GANC rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301410, the custom clone sequence may differ by one or more nucleotides


ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT
GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT
GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTCAGGTGC
CAGGACCAGAGCCCAACAACTCTGGATGCCTTCAAAGGCAAAGAAACCACAGTCCAGGAGGAGACACAGG
ATCTCAGCACAAGACAGCACCTGGCTCAAAAGGAAGCTGAGGAGCCTGATAAACAAGGACAAATTACCTG
GGACATCAGCAACGTAGCTCCCAAGACTGAGAACTTTGAGGACCTCTTGGAACAAACTCCATGCTCAGCC
TGTTTGCAAGGTTTCACCAGAGACAACACTTCCAGCAGCTTCTCCGAGGATGCAGGAATATCTCTGAGCA
CCTCTGTGAAGTTACCCCTTGCCTCTTCATCTAAGCCTAATGAAAATGAAGCTTTGCCCAACCAGCCACC
TTCTCAGCAGATAAGGCACAACTACCGCTTATTAGCCAGTACTGTGTCTGCAGAAATGGCCAGGAACAGG
CAGCTAATTTGGGAACTGGCCAGACAATCAGAAGCACACCTGGACAGGCCAGTTGTCCTTGGGGAACAGG
CCAGTGCCCAGCGTGAGGTTGCCAGTATTCTTTGTAGAAAATCAGTGCTTGCAATAAACCAACTGGCTGC
AACTGTAGAAGGGACAATTAGTGTCCTACAGCAATTTAATGAACTATTAGACCATCCTCTGGATCCCGGG
AGGTCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301410
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301410.1, NP_001288339.1
RefSeq Size 1559 bp
RefSeq ORF 849 bp
Locus ID 2595
Protein Families Druggable Genome
Protein Pathways Galactose metabolism, Metabolic pathways, Starch and sucrose metabolism
Gene Summary Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) lacks several exons in the 3' coding region, and contains an alternate 3' structure, compared to variant 1. It encodes isoform 3 which is shorter, and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...