TRA2A (NM_001282758) Human Untagged Clone
CAT#: SC334229
TRA2A (untagged) - Human transformer 2 alpha homolog (Drosophila) (TRA2A), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AWMS1; HSU53209 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282758, the custom clone sequence may differ by one or more nucleotides
ATGTCTAACCGGAGAAGACATACTGGCAGCAGGGCAAATCCAGATCCCAACACTTGCCTTGGAGTGTTTG GCCTCAGTTTGTACACAACAGAGAGGGATCTTCGTGAAGTATTTTCTCGATATGGACCATTGAGTGGTGT CAATGTGGTTTATGATCAGCGAACTGGGCGATCTCGAGGATTTGCTTTTGTGTATTTTGAGAGAATAGAT GACTCAAAGGAGGCTATGGAAAGGGCAAATGGAATGGAGCTGGATGGTAGAAGAATTCGGGTGGATTATT CTATAACCAAGAGAGCGCACACACCAACACCAGGCATCTACATGGGCAGACCAACTCATAGTGGTGGGGG TGGTGGAGGAGGCGGCGGCGGTGGAGGTGGAGGTGGTGGCAGACGTCGAGATTCTTACTATGATAGAGGA TATGATCGTGGGTATGACAGATATGAAGACTATGATTACCGATACAGAAGACGATCACCTTCTCCTTATT ATAGTCGATATAGATCACGATCAAGATCTCGTTCCTACAGCCCAAGACGCTATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282758 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282758.1, NP_001269687.1 |
RefSeq Size | 1956 bp |
RefSeq ORF | 546 bp |
Locus ID | 29896 |
UniProt ID | Q13595 |
Protein Pathways | Spliceosome |
Gene Summary | This gene is a member of the transformer 2 homolog family and encodes a protein with several RRM (RNA recognition motif) domains. This phosphorylated nuclear protein binds to specific RNA sequences and plays a role in the regulation of pre-mRNA splicing. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (3) contains an additional exon in the 5' region that results in translation initiation from an in-frame downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...