TRA2A (NM_001282758) Human Untagged Clone

CAT#: SC334229

TRA2A (untagged) - Human transformer 2 alpha homolog (Drosophila) (TRA2A), transcript variant 3



  "NM_001282758" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-TRA-2a antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AWMS1; HSU53209
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282758, the custom clone sequence may differ by one or more nucleotides


ATGTCTAACCGGAGAAGACATACTGGCAGCAGGGCAAATCCAGATCCCAACACTTGCCTTGGAGTGTTTG
GCCTCAGTTTGTACACAACAGAGAGGGATCTTCGTGAAGTATTTTCTCGATATGGACCATTGAGTGGTGT
CAATGTGGTTTATGATCAGCGAACTGGGCGATCTCGAGGATTTGCTTTTGTGTATTTTGAGAGAATAGAT
GACTCAAAGGAGGCTATGGAAAGGGCAAATGGAATGGAGCTGGATGGTAGAAGAATTCGGGTGGATTATT
CTATAACCAAGAGAGCGCACACACCAACACCAGGCATCTACATGGGCAGACCAACTCATAGTGGTGGGGG
TGGTGGAGGAGGCGGCGGCGGTGGAGGTGGAGGTGGTGGCAGACGTCGAGATTCTTACTATGATAGAGGA
TATGATCGTGGGTATGACAGATATGAAGACTATGATTACCGATACAGAAGACGATCACCTTCTCCTTATT
ATAGTCGATATAGATCACGATCAAGATCTCGTTCCTACAGCCCAAGACGCTATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282758
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282758.1, NP_001269687.1
RefSeq Size 1956 bp
RefSeq ORF 546 bp
Locus ID 29896
UniProt ID Q13595
Protein Pathways Spliceosome
Gene Summary This gene is a member of the transformer 2 homolog family and encodes a protein with several RRM (RNA recognition motif) domains. This phosphorylated nuclear protein binds to specific RNA sequences and plays a role in the regulation of pre-mRNA splicing. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) contains an additional exon in the 5' region that results in translation initiation from an in-frame downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...