PPP2R5A (NM_001199756) Human Untagged Clone

CAT#: SC331355

PPP2R5A (untagged) - Homo sapiens protein phosphatase 2, regulatory subunit B', alpha (PPP2R5A), transcript variant 2



  "NM_001199756" in other vectors (2)

CNY 4,090.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PPP2R5A Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B56A; B56alpha; PR61A
Vector pCMV6-Entry
Sequence Data
>SC331355 representing NM_001199756.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATAATGAATGCCACTTCAAATGAACAACAAGAGCTTTTCTGTCAGAAGTTGCAGCAGTGTTGTATA
CTGTTTGATTTCATGGACTCTGTTTCAGACTTGAAGAGCAAAGAAATTAAAAGAGCAACACTGAATGAA
CTGGTTGAGTATGTTTCAACTAATCGTGGTGTAATTGTTGAATCAGCGTATTCTGATATAGTAAAAATG
ATCAGTGCTAACATCTTCCGTACACTTCCTCCAAGTGATAATCCAGATTTTGATCCAGAAGAGGATGAA
CCCACGCTTGAGGCCTCTTGGCCTCACATACAGTTGGTATATGAATTCTTCTTGAGATTTTTGGAGAGC
CCTGATTTCCAGCCTAGCATTGCAAAACGATACATTGATCAGAAATTCGTACAACAGCTCCTGGAGCTT
TTTGATAGTGAAGATCCCAGAGAACGTGACTTCCTGAAGACTGTTCTGCACCGAATTTATGGGAAATTT
CTTGGATTAAGAGCATTCATCAGAAAACAAATTAACAACATTTTCCTCAGGTTTATATATGAAACAGAA
CATTTCAATGGTGTTGCTGAACTTCTTGAAATATTAGGAAGTATTATCAATGGCTTTGCATTGCCACTG
AAAGCAGAACATAAACAATTTCTAATGAAGGTTCTTATTCCTATGCATACTGCAAAAGGATTAGCTTTG
TTTCATGCTCAGCTAGCATATTGTGTTGTACAGTTCCTGGAGAAAGATACAACACTAACAGAGCCAGTG
ATCAGAGGACTGCTGAAATTTTGGCCAAAAACCTGCAGTCAGAAAGAGGTGATGTTTTTAGGAGAAATT
GAAGAAATCTTAGATGTCATTGAACCAACACAGTTCAAAAAAATTGAAGAGCCACTTTTCAAGCAGATA
TCCAAGTGTGTATCCAGTTCTCATTTTCAGGTTGCAGAAAGGGCATTGTACTTCTGGAATAACGAATAT
ATTCTTAGTTTGATTGAGGAGAACATTGATAAAATTCTGCCAATTATGTTTGCCAGTTTGTACAAAATT
TCCAAAGAACACTGGAATCCGACCATTGTAGCACTGGTATACAATGTGCTGAAAACCCTAATGGAAATG
AATGGCAAGCTTTTCGATGACCTTACTAGCTCATACAAAGCTGAAAGACAGAGAGAGAAAAAGAAGGAA
TTGGAACGTGAAGAATTATGGAAAAAATTAGAGGAGCTAAAGCTAAAGAAAGCTCTAGAAAAACAGAAT
AGTGCTTACAACATGCACAGTATTCTCAGCAATACAAGTGCCGAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001199756
Insert Size 1290 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199756.1
RefSeq Size 2667 bp
RefSeq ORF 1290 bp
Locus ID 5525
UniProt ID Q15172
Protein Families Druggable Genome, Phosphatase
Protein Pathways Oocyte meiosis, Wnt signaling pathway
MW 50.2 kDa
Gene Summary The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...