PKIB (NM_001270394) Human Untagged Clone
CAT#: SC330821
PKIB (untagged) - Homo sapiens protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 5
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRKACN2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330821 representing NM_001270394.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCACACCAGGATGTTGCTATGAGGACAGATTCATCAAAAATGACTGACGTGGAGTCTGGGGTCGCC AATTTTGCATCTTCAGCAAGGGCAGGCCGCCGGAATGCCTTACCAGACATCCAGAGTTCAGCTGCCACA GACGGAACCTCAGATTTGCCCCTCAAACTGGAGGCTCTCTCCGTGAAGGAAGATGCAAAAGAGAAAGAT GAAAAAACAACACAAGACCAATTGGAAAAGCCTCAAAATGAAGAAAAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270394 |
Insert Size | 258 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001270394.1 |
RefSeq Size | 1953 bp |
RefSeq ORF | 258 bp |
Locus ID | 5570 |
UniProt ID | Q9C010 |
Protein Families | Druggable Genome |
MW | 9.2 kDa |
Gene Summary | This gene encodes a member of the cAMP-dependent protein kinase inhibitor family. The encoded protein may play a role in the protein kinase A (PKA) pathway by interacting with the catalytic subunit of PKA, and overexpression of this gene may play a role in prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (5) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. Variants 5 and 6 encode the same isoform (2), which is longer and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231583 | PKIB (Myc-DDK tagged) - Homo sapiens protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 5 |
CNY 3,990.00 |
|
RG231583 | PKIB (tGFP-tagged) - Homo sapiens protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 5 |
CNY 4,370.00 |