TPD52L2 (NM_001243892) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	D54; TPD54
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330192 representing NM_001243892. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGACTCCGCCGGCCAAGGTGTGGCTGCCCGGACTCCTGCTGTTGAGGGTCTGACAGAGGCTGAGGAG GAGGAGCTCAGGGCTGAGCTTACCAAGGTGGAAGAGGAAATTGTCACTCTGCGCCAGGTCCTGGCAGCC AAGGAGAGGCACTGTGGAGAGCTCAAGAGGAGGCTGGGCCTCTCCACCCTGGGGGAGCTGAAACAGAAC CTGTCCAGGAGCTGGCATGACGTGCAGGTCTCTAGCGCCTACAAGAAGACTCAGGAAACTCTTTCACAG GCAGGACAGAAGACTTCAGCTGCCCTGTCCACAGTGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATG AGGAACTCTGCGACCTTCAAGTCGTTTGAGGACCGAGTTGGGACCATAAAGTCTAAGGTTGTGGGTGAC AGAGAGAACGGCAGTGACAACCTCCCTTCCTCAGCGGGGAGTGGTGACAAGCCCCTGTCGGATCCCGCA CCTTTCTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001243892
Insert Size	492 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001243892.1
RefSeq Size	2230 bp
RefSeq ORF	492 bp
Locus ID	7165
UniProt ID	O43399
MW	17.5 kDa
Gene Summary	This gene encodes a member of the tumor protein D52-like family. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. Expression of this gene may be a marker for breast cancer and acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (8) uses an alternate splice site and lacks three exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (h) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.