United States
Germany
Japan
United Kingdom
China
MNX1 (NM_001165255) Human Untagged Clone
CAT＃: SC326758
MNX1 (untagged)-Human motor neuron and pancreas homeobox 1 (MNX1) transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HB9; HLXB9; HOXHB9; SCRA1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001165255 edited
ATGGGGGGACTCTCAACAGTAGGTGCCTGCCCTGGAATCCTGGGCGCCCAACAAGCCCAG GCGCAGTCGAACCTCCTGGGGAAGTGCCGCCGGCCGCGCACCGCCTTCACCAGCCAGCAG CTGCTGGAGCTGGAGCACCAGTTCAAGCTCAACAAGTACCTGTCGCGGCCCAAGCGCTTC GAGGTGGCCACCTCGCTCATGCTCACCGAGACCCAGGTGAAGATTTGGTTCCAGAACCGG CGGATGAAATGGAAACGCAGCAAAAAGGCCAAAGAGCAGGCGGCGCAGGAAGCGGAGAAA CAGAAGGGCGGCGGCGGGGGCGCGGGGAAGGGCGGCGCGGAGGAGCCGGGAGCCGAGGAG CTGCTGGGGCCGCCAGCGCCCGGAGACAAGGGCAGCGGACGCCGCCTGCGGGACTTGAGG GACAGTGACCCCGAGGAGGACGAGGACGAGGACGACGAGGACCATTTCCCCTACAGCAAC GGCGCCAGCGTCCACGCCGCCTCCTCCGACTGCTCCTCGGAGGACGACTCGCCGCCCCCG CGGCCCAGCCACCAGCCCGCGCCCCAGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001165255 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001165255.1, NP_001158727.1 |
| RefSeq Size | 1620 bp |
| RefSeq ORF | 570 bp |
| Locus ID | 3110 |
| UniProt ID | P50219 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
| Protein Pathways | Maturity onset diabetes of the young |
| Gene Summary | This gene encodes a nuclear protein, which contains a homeobox domain and is a transcription factor. Mutations in this gene result in Currarino syndrome, an autosomic dominant congenital malformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228123 | MNX1 (Myc-DDK-tagged)-Human motor neuron and pancreas homeobox 1 (MNX1), transcript variant 2 |
CNY 3,990.00 |
|
| RC228123L3 | Lenti-ORF clone of MNX1 (Myc-DDK-tagged)-Human motor neuron and pancreas homeobox 1 (MNX1), transcript variant 2 |
CNY 5,890.00 |
|
| RC228123L4 | Lenti-ORF clone of MNX1 (mGFP-tagged)-Human motor neuron and pancreas homeobox 1 (MNX1), transcript variant 2 |
CNY 5,890.00 |
|
| RG228123 | MNX1 (tGFP-tagged) - Human motor neuron and pancreas homeobox 1 (MNX1), transcript variant 2 |
CNY 4,370.00 |
