United States
Germany
Japan
United Kingdom
China
CD55 (NM_000574) Human Untagged Clone
CAT＃: SC322226
CD55 (untagged)-Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1
CNY 3,656.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CHAPLE; CR; CROM; DAF; TC |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322226
GCAACTCGCTCCGGCCGCTGGGCGTAGCTGCGACTCGGCGGAGTCCCGGCGGCGCGTCCT
TGTTCTAACCCGGCGCGCCATGACCGTCGCGCGGCCGAGCGTGCCCGCGGCGCTGCCCCT CCTCGGGGAGCTGCCCCGGCTGCTGCTGCTGGTGCTGTTGTGCCTGCCGGCCGTGTGGGG TGACTGTGGCCTTCCCCCAGATGTACCTAATGCCCAGCCAGCTTTGGAAGGCCGTACAAG TTTTCCCGAGGATACTGTAATAACGTACAAATGTGAAGAAAGCTTTGTGAAAATTCCTGG CGAGAAGGACTCAGTGATCTGCCTTAAGGGCAGTCAATGGTCAGATATTGAAGAGTTCTG CAATCGTAGCTGCGAGGTGCCAACAAGGCTAAATTCTGCATCCCTCAAACAGCCTTATAT CACTCAGAATTATTTTCCAGTCGGTACTGTTGTGGAATATGAGTGCCGTCCAGGTTACAG AAGAGAACCTTCTCTATCACCAAAACTAACTTGCCTTCAGAATTTAAAATGGTCCACAGC AGTCGAATTTTGTAAAAAGAAATCATGCCCTAATCCGGGAGAAATACGAAATGGTCAGAT TGATGTACCAGGTGGCATATTATTTGGTGCAACCATCTCCTTCTCATGTAACACAGGGTA CAAATTATTTGGCTCGACTTCTAGTTTTTGTCTTATTTCAGGCAGCTCTGTCCAGTGGAG TGACCCGTTGCCAGAGTGCAGAGAAATTTATTGTCCAGCACCACCACAAATTGACAATGG AATAATTCAAGGGGAACGTGACCATTATGGATATAGACAGTCTGTAACGTATGCATGTAA TAAAGGATTCACCATGATTGGAGAGCACTCTATTTATTGTACTGTGAATAATGATGAAGG AGAGTGGAGTGGCCCACCACCTGAATGCAGAGGAAAATCTCTAACTTCCAAGGTCCCACC AACAGTTCAGAAACCTACCACAGTAAATGTTCCAACTACAGAAGTCTCACCAACTTCTCA GAAAACCACCACAAAAACCACCACACCAAATGCTCAAGCAACACGGAGTACACCTGTTTC CAGGACAACCAAGCATTTTCATGAAACAACCCCAAATAAAGGAAGTGGAACCACTTCAGG TACTACCCGTCTTCTATCTGGGCACACGTGTTTCACGTTGACAGGTTTGCTTGGGACGCT AGTAACCATGGGCTTGCTGACTTAGCCAAAGAAGAGTTAAGAAGAAAATACACACAAGTA TACAGACTGTTCCTAGTTTCTTAGACTTATCTGCATATTGGATAAAATAAATGCAATTGT GCTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_000574 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_000574.2, NP_000565.1 |
| RefSeq Size | 2308 bp |
| RefSeq ORF | 1146 bp |
| Locus ID | 1604 |
| UniProt ID | P08174 |
| Domains | CCP |
| Protein Families | Druggable Genome |
| Protein Pathways | Complement and coagulation cascades, Hematopoietic cell lineage, Viral myocarditis |
| Gene Summary | This gene encodes a glycoprotein involved in the regulation of the complement cascade. Binding of the encoded protein to complement proteins accelerates their decay, thereby disrupting the cascade and preventing damage to host cells. Antigens present on this protein constitute the Cromer blood group system (CROM). Alternative splicing results in multiple transcript variants. The predominant transcript variant encodes a membrane-bound protein, but alternatively spliced transcripts may produce soluble proteins. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (1) encodes isoform 1 (also known as gDAF), which is membrane-associated. Sequence Note: This RefSeq record represents the CD55*001.1.1 allele. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Conditional gene knockout and reconstitution in human iPSCs with an inducible Cas9 system
,Wu, M;Liu, S;Gao, Y;Bai, H;Machairaki, V;Li, G;Chen, T;Cheng, L;,
Stem Cell Res
,PubMed ID 29554589
[CD55]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201615 | CD55 (Myc-DDK-tagged)-Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1 |
CNY 3,656.00 |
|
| RC201615L1 | Lenti ORF clone of Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC201615L2 | Lenti ORF clone of Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
| RC201615L3 | Lenti ORF clone of Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC201615L4 | Lenti ORF clone of Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
| RG201615 | CD55 (tGFP-tagged) - Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1 |
CNY 5,256.00 |
|
| SC119802 | CD55 (untagged)-Human CD55 molecule, decay accelerating factor for complement (Cromer blood group) (CD55), transcript variant 1 |
CNY 3,656.00 |
