H2BC12 (NM_080593) Human Untagged Clone

CAT#: SC322213

HIST1H2BK (untagged)-Human histone cluster 1, H2bk (HIST1H2BK)



  "NM_080593" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


H2BC12 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H2B/S; H2BFAiii; H2BFT; H2BK; HIST1H2BK
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322213 CTCGATCTGCTGCTCGTCTCAGGCTCGTAGTTCGCCTTCAACATGCCGGAACCAGCGAAG
TCCGCTCCCGCGCCCAAGAAGGGCTCGAAGAAAGCCGTGACTAAGGCGCAGAAGAAGGAC
GGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTG
AAGCAGGTCCACCCCGACACCGGCATCTCCTCTAAGGCCATGGGAATCATGAACTCCTTC
GTCAACGACATCTTCGAACGCATCGCGGGTGAGGCTTCCCGCCTGGCGCATTACAACAAG
CGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAG
TTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCCGTCACCAAGTACACCAGCGCTAAG
TAAACTTGCCAAGGAGGGACTTTCTCTGGAATTTCCTGATATGACCAAGAAAGCTTCTTA
TCAAAAGAAGCACAATTGCCTTCGGTTACCTCATTATCTACTGCAGAAAAGAAGACGAGA
ATGCAACCATACCTAGATGGACTTTTCCACAAGCTAAAGCTGGCCTCTTGATCTCATTCA
GATTCCAAAGAGAATCATTTACAAGTTAATTTCTGTCTCCTTGGTCCATTCCTTCTCTCT
AATAATCATTTACTGTTCCTCAAAGAATTGTCTACATTACCCATCTCCTCTTTTGCCTCT
GAGAAAGAGTATATAAGCTTCTGTACCCCACTGGGGGGTTGGGGTAATATTCTGTGGTCC
TCAGCCCTGTACCTTAATAAATTTGTATGCCTTTTCTCTTAAAAAAAAAAAAAAAAAAAA
AAAAA
Restriction Sites Please inquire     
ACCN NM_080593
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_080593.1, NP_542160.1
RefSeq Size 820 bp
RefSeq ORF 381 bp
Locus ID 85236
UniProt ID O60814
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. The protein encoded is an antimicrobial protein with antibacterial and antifungal activity. Two transcripts that encode the same protein have been identified for this gene, which is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (2) differs from variant 1 in its 3' UTR which contains a polyA signal and site. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...