PARK7 (NM_001123377) Human Untagged Clone
CAT#: SC318792
PARK7 (untagged)-Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DJ-1; DJ1; GATD2; HEL-S-67p |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC318792 representing NM_001123377.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTCATCCCTGTA GATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCTGGCTGGAAAAGACCCAGTACAGTGT AGCCGTGATGTGGTCATTTGTCCTGATGCCAGCCTTGAAGATGCAAAAAAAGAGGGACCATATGATGTG GTGGTTCTACCAGGAGGTAATCTGGGCGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTG AAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCAT GAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCAT TACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGC TTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCA CTTGTTCTTAAAGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001123377 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001123377.1 |
RefSeq Size | 921 bp |
RefSeq ORF | 570 bp |
Locus ID | 11315 |
UniProt ID | Q99497 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Parkinson's disease |
MW | 19.9 kDa |
Gene Summary | The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) represents the shorter transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225206 | PARK7 (Myc-DDK-tagged)-Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2 |
CNY 2,400.00 |
|
RC225206L1 | Lenti ORF clone of Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225206L2 | Lenti ORF clone of Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC225206L3 | Lenti ORF clone of Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225206L4 | Lenti ORF clone of Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225206 | PARK7 (tGFP-tagged) - Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2 |
CNY 4,370.00 |