United States
Germany
Japan
United Kingdom
China
VTI1A (NM_145206) Human Untagged Clone
CAT＃: SC317321
VTI1A (untagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A)
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MMDS3; MVti1; Vti1-rp2; VTI1RP2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317321 representing NM_145206.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGTCCGACTTCGAAGGTTACGAGCAGGACTTCGCGGTGCTCACTGCAGAGATCACCAGCAAGATT GCGAGGGTCCCACGACTCCCGCCTGATGAAAAGAAACAGATGGTTGCAAATGTGGAGAAACAGCTTGAA GAAGCGAAAGAACTGCTTGAACAGATGGATTTGGAAGTCCGAGAGATACCACCCCAAAGTCGAGGGATG TACAGCAACAGAATGAGAAGCTACAAACAAGAAATGGGAAAACTCGAAACAGATTTTAAAAGGTCACGG ATCGCCTACAGTGACGAAGTACGGAATGAGCTCCTGGGGGATGATGGGAATTCCTCAGAGAACCAGAGG GCACATCTGCTCGATAACACAGAGAGGCTGGAAAGGTCATCTCGGAGACTAGAGGCTGGATACCAAATA GCAGTGGAAACCGAGCAAATTGGTCAGGAGATGTTGGAAAACCTTAGTCATGACAGAGAAAAGATACAG CGAGCACGTGAAAGACTTCGGGAAACAGATGCTAATTTGGGAAAAAGCTCCAGGATTCTGACAGGGATG TTGCGAAGAATCATCCAGAACCGCATCCTGCTCGTCATCCTAGGGATCATCGTGGTCATCACCATCCTG ATGGCGATCACTTTTTCTGTCAGAAGACACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_145206 |
| Insert Size | 654 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145206.3 |
| RefSeq Size | 4417 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 143187 |
| UniProt ID | Q96AJ9 |
| Domains | V-SNARE |
| Protein Families | Transmembrane |
| Protein Pathways | SNARE interactions in vesicular transport |
| MW | 25.2 kDa |
| Gene Summary | The protein encoded by this gene is a member of the family of soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors (SNAREs) that function in intracellular trafficking. This family member is involved in vesicular transport between endosomes and the trans-Golgi network. It is a vesicle-associated SNARE (v-SNARE) that interacts with target membrane SNAREs (t-SNAREs). Polymorphisms in this gene have been associated with binocular function, and also with susceptibility to colorectal and lung cancers. A recurrent rearrangement has been found between this gene and the transcription factor 7-like 2 (TCF7L2) gene in colorectal cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213934 | VTI1A (Myc-DDK-tagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) |
CNY 2,400.00 |
|
| RC213934L1 | Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC213934L2 | Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), mGFP tagged |
CNY 5,890.00 |
|
| RC213934L3 | Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213934L4 | Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), mGFP tagged |
CNY 4,800.00 |
|
| RG213934 | VTI1A (tGFP-tagged) - Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) |
CNY 4,000.00 |
|
| SC309124 | VTI1A (untagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) |
CNY 2,400.00 |
