UQCRHL (NM_001089591) Human Untagged Clone
CAT#: SC316097
UQCRHL (untagged)-Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316097 representing NM_001089591.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGACTGGAGGACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGAGGAAGAGGAAGAG GAGGAATTAGTGGATCCCCTAACAACAGTGAGAGAGCAATGCGAGCAGTTGGAGAAATGTGTAAAGGCC CGGGAGCGGCTAGAGCTCTATGATGAGCATGTATCCTCTCGATCACATACAGAAGAGGATTGCACGGAG GAGCTCTTTGACTTCTTGCATGCAAAGGACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001089591 |
Insert Size | 276 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001089591.1 |
RefSeq Size | 538 bp |
RefSeq ORF | 276 bp |
Locus ID | 440567 |
UniProt ID | A0A096LP55 |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 10.8 kDa |
Gene Summary | This gene has characteristics of a pseudogene derived from the UQCRH gene. However, there is still an open reading frame that could produce a protein of the same or nearly the same size as that of the UQCRH gene, so this gene is being called protein-coding for now. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219881 | UQCRHL (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL) |
CNY 1,200.00 |
|
RC219881L3 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219881L4 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL), mGFP tagged |
CNY 5,890.00 |
|
RG219881 | UQCRHL (tGFP-tagged) - Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL) |
CNY 4,370.00 |