TBL1Y (NM_134259) Human Untagged Clone
CAT#: SC313842
TBL1Y (untagged)-Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3
CNY 5,840.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNY2; TBL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_134259, the custom clone sequence may differ by one or more nucleotides
ATGAGCATAACCAGTGACGAGGTGAACTTTCTGGTTTATCGGTATCTCCAGGAGTCAGGTTTTTCTCACT CGGCTTTCACGTTTGGGATCGAGAGCCACATCAGCCAGTCCAACATCAATGGGACACTAGTGCCACCGTC TGCCCTCATCTCCATTCTCCAGAAGGGACTGCAGTATGTAGAGGCTGAGATAAGCATCAACAAGGATGGC ACAGTGTTCGACAGCCGCCCTATAGAGTCCCTGTCCCTGATAGTTGCTGTGATTCCTGATGTGGTGCAGA TGCGGCAGCAGGCATTTGGAGAGAAGCTCACTCAGCAGCAAGCCAGTGCAGCAGCCACAGAGGCATCAGC AATGGCAAAGGCGGCAACCATGACCCCAGCTGCTATTTCCCAGCAAAATCCTCCAAAGAACCGAGAGGCC ACAGTGAACGGGGAAGAGAATGGAGCACATGAAATCAATAATCACTCAAAGCCAATGGAAATAGATGGGG ATGTTGAGATTCCACCCAACAAAGCCACAGTCCTTCGGGGCCACGAGTCTGAGGTGTTCATTTGTGCCTG GAACCCTGTCAGTGATTTGCTAGCCTCTGGATCTGGAGACTCAACTGCAAGGATATGGAACCTGAATGAG AATAGCAACGGGGGCTCCACCCAGCTCGTGTTGAGACATTGTATACGAGAAGGGGGGCACGACGTCCCAA GTAATAAAGATGTCACCTCACTGGACTGGAACAGTGATGGAACACTATTGGCTATGGGTTCATATGATGG TTTCGCAAGAATATGGACAGAAAATGGTAACCTGGCCAGCACCTTAGGCCAACATAAAGGCCCCATCTTC GCTCTGAAATGGAACAAAAAGGGGAATTATGTTTTGAGTGCTGGTGTAGACAAAACAACAATAATTTGGG ATGCTCACACAGGAGAAGCCAAACAGCAGTTTCCTTTTCATTCAGCCCCCGCCCTTGATGTGGACTGGCA GAACAACATGACCTTTGCCTCCTGTAGCACAGACATGTGTATCCATGTGTGCAGGCTCGGCTGTGACCAC CCAGTCAAAACCTTCCAGGGACACACAAACGAGGTCAATGCCATCAAATGGGATCCTTCTGGAATGTTGC TGGCGTCCTGCTCGGATGACATGACATTGAAGATCTGGAGTATGAAGCAGGATGCATGCGTCCACGATCT TCAGGCTCACAGCAAAGAGATCTACACCATCAAGTGGAGCCCCACCGGGCCTGCCACCAGCAACCCAAAC TCCAGCATCATGTTGGCAAGTGCTTCATTTGATTCTACAGTGCGACTGTGGGATGTGGAGCAAGGTGTCT GCACCCACACACTCATGAAGCATCAAGAGCCTGTCTACAGTGTAGCTTTCAGCCCCGATGGAAAGTACTT GGCTAGTGGATCCTTTGACAAGTATGTTCATATCTGGAATACTCAGAGTGGAAGTCTCGTCCACAGCTAC CAAGGCACTGGCGGTATCTTCGAGGTGTGCTGGAACGCCCGAGGAGATAAAGTGGGCGCCAGCGCGTCTG ATGGCTCTGTGTGTGTTCTGGATCTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_134259 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_134259.1, NP_599021.1 |
RefSeq Size | 2312 bp |
RefSeq ORF | 1569 bp |
Locus ID | 90665 |
UniProt ID | Q9BQ87 |
Domains | WD40, LisH |
Protein Families | Transcription Factors |
Protein Pathways | Wnt signaling pathway |
Gene Summary | The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene is highly similar to TBL1X gene in nucleotide sequence and protein sequence, but the TBL1X gene is located on chromosome X and this gene is on chromosome Y. This gene has three alternatively spliced transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an exon (95 bases) in the 5' UTR, as compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212240 | TBL1Y (Myc-DDK-tagged)-Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3 |
CNY 5,832.00 |
|
RC212240L1 | Lenti ORF clone of Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3, Myc-DDK-tagged |
CNY 8,232.00 |
|
RC212240L2 | Lenti ORF clone of Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC212240L3 | Lenti ORF clone of Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212240L4 | Lenti ORF clone of Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG212240 | TBL1Y (tGFP-tagged) - Human transducin (beta)-like 1, Y-linked (TBL1Y), transcript variant 3 |
CNY 4,370.00 |