United States
Germany
Japan
United Kingdom
China
ATP1B2 (NM_001678) Human Untagged Clone
CAT＃: SC312822
ATP1B2 (untagged)-Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2)
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AMOG |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC312822 representing NM_001678.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCATCCAGAAAGAGAAGAAGAGCTGCGGGCAGGTGGTTGAGGAGTGGAAGGAGTTCGTGTGGAAC CCGAGGACGCACCAGTTTATGGGCCGCACCGGGACCAGCTGGGCCTTTATCCTCCTCTTCTACCTCGTT TTTTATGGGTTCCTCACCGCCATGTTCACCCTCACCATGTGGGTGATGCTGCAGACTGTCTCCGACCAT ACCCCCAAGTACCAGGACCGACTGGCCACACCGGGCTTGATGATTCGCCCCAAGACTGAGAACCTTGAT GTCATTGTCAATGTCAGTGACACTGAAAGCTGGGACCAGCATGTTCAGAAGCTCAACAAGTTCTTGGAG CCTTACAACGACTCTATCCAAGCCCAAAAGAATGATGTCTGCCGCCCTGGACGCTATTACGAACAGCCA GATAATGGAGTCCTCAACTACCCCAAACGTGCCTGCCAATTCAACCGGACCCAGCTGGGCAACTGCTCC GGCATTGGGGACTCCACCCACTATGGTTACAGCACTGGGCAGCCCTGTGTCTTCATCAAGATGAACCGG GTCATCAACTTCTATGCAGGAGCAAACCAGAGCATGAATGTTACCTGTGCTGGGAAGCGAGATGAAGAT GCTGAGAATCTCGGCAACTTCGTCATGTTCCCCGCCAACGGCAACATCGACCTCATGTACTTCCCCTAC TATGGCAAAAAGTTCCACGTGAACTACACACAGCCCCTGGTGGCTGTGAAGTTCCTGAATGTGACCCCC AACGTGGAGGTGAATGTAGAATGTCGCATCAACGCCGCCAACATCGCCACAGACGATGAGCGAGACAAG TTCGCCGGCCGCGTGGCCTTCAAACTCCGCATCAACAAAACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001678 |
| Insert Size | 873 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001678.4 |
| RefSeq Size | 3396 bp |
| RefSeq ORF | 873 bp |
| Locus ID | 482 |
| UniProt ID | P14415 |
| Domains | Na_K-ATPase |
| Protein Families | Transmembrane |
| Protein Pathways | Cardiac muscle contraction |
| MW | 33.4 kDa |
| Gene Summary | The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220004 | ATP1B2 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2) |
CNY 2,400.00 |
|
| RC220004L1 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC220004L2 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), mGFP tagged |
CNY 5,890.00 |
|
| RC220004L3 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220004L4 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), mGFP tagged |
CNY 5,890.00 |
|
| RG220004 | ATP1B2 (tGFP-tagged) - Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2) |
CNY 4,370.00 |
