CAMK2B (NM_172084) Human Untagged Clone

CAT#: SC309460

CAMK2B (untagged)-Human calcium/calmodulin-dependent protein kinase II beta (CAMK2B), transcript variant 8



  "NM_172084" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CAMK2B mouse monoclonal antibody, clone OTI8D9 (formerly 8D9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAM2; CAMK2; CAMKB; CaMKIIbeta; MRD54
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309460 representing NM_172084.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATTGGCAAGGGG
GCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTATGCAGCCAAGATCATCAAC
ACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGAGAGGCTCGGATCTGCCGCCTTCTGAAG
CATTCCAACATCGTGCGTCTCCACGACAGCATCTCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTG
GTCACTGGTGGGGAGCTCTTTGAAGACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCAC
TGTATCCAGCAGATCCTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAG
CCGGAGAACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTAGCT
ATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTACCTGTCCCCTGAG
GTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGTGGGGTGATCCTGTACATCCTG
CTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCACAAGCTGTACCAGCAGATCAAGGCTGGTGCC
TATGACTTCCCGTCCCCTGAGTGGGACACCGTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTG
ACCATCAACCCTGCCAAGCGCATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCC
ACGGTAGCATCCATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAG
CTCAAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGCCCGGAAGCAGGAGATCATT
AAGACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATCTGTGAC
CCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATGGACTTCCACAGATTC
TACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACGACCATCCTGAACCCACACGTGCAC
GTCATTGGAGAGGATGCCGCCTGCATCGCTTACATCCGGCTCACGCAGTACATTGACGGGCAGGGCCGG
CCCCGCACCAGCCAGTCTGAGGAGACCCGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCAC
TTCCACTGCTCGGGCGCGCCTGTGGCCCCGCTGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_172084
Insert Size 1350 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172084.2
RefSeq Size 3935 bp
RefSeq ORF 1350 bp
Locus ID 816
UniProt ID Q13554
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Calcium signaling pathway, ErbB signaling pathway, Glioma, GnRH signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Wnt signaling pathway
MW 51 kDa
Gene Summary The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (8), also known as beta 7, lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (8), also known as beta 7 subunit, that is missing an internal segment compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...