CREM (NM_182721) Human Untagged Clone

CAT#: SC307496

CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 8



  "NM_182721" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CREM mouse monoclonal antibody,clone OTI7A2
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CREM-2; hCREM-2; ICER
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_182721, the custom clone sequence may differ by one or more nucleotides
ATGAACAGAACTCAGGAGTTGTCTGGCCAGCTTAGTGCTGCCACTGGTGACATGCCAACT
TACCAGATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCC
GGAAGTTTGCACAGTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGG
CTAATGAAAAACAGGGAAGCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAATATGTCAAA
TGTCTTGAAAATCGTGTGGCTGTGCTTGAAAACCAAAACAAGACTCTCATTGAGGAACTC
AAGGCCCTCAAAGATCTTTATTGCCATAAAGTAGAGTAA
Restriction Sites Please inquire     
ACCN NM_182721
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182721.1, NP_874390.1
RefSeq Size 2065 bp
RefSeq ORF 339 bp
Locus ID 1390
UniProt ID Q03060
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) uses an alternative downstream promoter, and differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. This results in a shorter isoform (8, also known as h) with distinct N- and C-termini, compared to isoform 1. This isoform represents one of the early repressor ICER isoforms. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...