Vegfa (NM_001110333) Rat Untagged Clone

CAT#: RN200263

Vegfa (untagged ORF) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 2, (10 ug)



  "NM_001110333" in other vectors (3)

CNY 3,990.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Vegf; VEGF-A; VEGF111; VEGF164; VPF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200263 representing NM_001110333
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

CTGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCGCCCACCTCCTCGCCGGCGGGCAGCCGACGG
TGGACGCGGCGGCGAGCCGCGAGCAGGAGCCGAAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGGGC
TCGCGGGATTGCACGGAAACTTTTCGTCCAACTTCTGGGCTCTTCTCTCTCCGGAGTAGCCGTGGTCTGC
GCCGCAGGAGGCAAACCGATCGGAGCTGGGAGAAGTGCTAGCTCGGGCCTGGAGAAGCCGGGGCCCGAGA
AGAGAGGGGAGAAAGAGAAGGAAGAGGAGAGGGGGCCGCAGTGGGCGCTCGGCTCTCGGGAGCCGGGCTC
ATGGACGGGTGAGGCGGCGGTGTGCGCAGACAGTGCTCCAGCCGCGCGCGCGCCCCAGGCCCCGGCCCGG
GCCTCGGTTCCAGAAGGGAGAGGAGCCCGCCAAGGCGCGCAAGAGAGCGGGCTGCCTCGCAGTCCGAGCC
GGAGAGGGAGCGCGAGCCGCGCCGGCCCCGGACGGGCCTCTGAAACCATGAACTTTCTGCTCTCTTGGGT
GCACTGGACCCTGGCTTTACTGCTGTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAA
GGGGAGCAGAAAGCCCATGAAGTGGTGAAGTTCATGGACGTCTACCAGCGCAGCTATTGCCGTCCAATTG
AGACCCTGGTGGACATCTTCCAGGAGTACCCCGATGAGATAGAGTATATCTTCAAGCCGTCCTGTGTGCC
CCTAATGCGGTGTGCGGGCTGCTGCAATGATGAAGCCCTGGAGTGCGTGCCCACGTCGGAGAGCAACGTC
ACTATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTGCAGCATA
GCAGATGTGAATGCAGACCAAAGAAAGATAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCG
GAGAAAGCATTTGTTTGTCCAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGC
AAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCAAGGCGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001110333
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001110333.2, NP_001103803.1
RefSeq Size 3474 bp
RefSeq ORF 1110 bp
Locus ID 83785
Gene Summary This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (2) lacks an in-frame, internal coding exon, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (2) represented in this RefSeq is derived from the CUG start codon and it lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...