SLC66A1 (NM_001040125) Human Untagged Clone
CAT#: SC310921
PQLC2 (untagged)-Human PQ loop repeat containing 2 (PQLC2), transcript variant 1
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LAAT-1; LAAT1; PQLC2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_001040125 edited
ATGGTCTGGAAGAAACTGGGCTCCCGCAACTTCTCCAGCTGCCCCAGTGGCTCCATCCAG TGGATATGGGATGTGTTGGGTGAATGTGCCCAGGACGGCTGGGACGAGGCCAGCGTGGGC CTGGGCTTGATCTCCATTCTCTGCTTTGCTGCATCTACCTTCCCCCAGTTCATCAAAGCC TACAAGACGGGCAACATGGACCAGGCGCTGTCCCTGTGGTTCCTCCTGGGCTGGATTGGC GGAGACTCCTGCAACCTCATCGGCTCCTTCCTTGCTGACCAGCTGCCCCTGCAGACCTAC ACGGCTGTGTATTATGTCTTGGCAGACCTGGTGATGCTGACGCTGTACTTTTACTACAAG TTCAGGACGCGCCCCTCTCTGTTGTCTGCCCCCATCAACTCCGTGCTGTTGTTCCTCATG GGGATGGCGTGCGCCACACCGCTGCTGAGTGCTGCTGGGCCCGTGGCTGCCCCTAGGGAA GCCTTCCGGGGGCGGGCGCTCCTGTCCGTGGAGTCGGGCAGCAAGCCCTTCACCCGGCAG GAAGTCATTGGCTTCGTCATCGGCTCCATCTCCAGCGTGTTGTACCTGCTTTCCCGGCTG CCTCAGATCCGCACCAACTTCCTCCGGAAGTCCACCCAGGGGATCTCCTACTCTCTGTTC GCGCTGGTGATGCTGGGGAACACGCTGTATGGGCTGAGCGTGCTGCTCAAAAACCCCGAG GAGGGCCAGAGCGAGGGCAGCTACCTGCTGCACCACCTGCCCTGGCTTGTGGGCAGCCTG GGCGTGCTGCTGCTCGACACCATCATCTCCATCCAGTTCCTGGTGTACAGGCGCAGCACC GCCGCCTCGGAGCTTGAGCCCCTCCTCCCCAGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001040125 |
| Insert Size | 1600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001040125.1, NP_001035214.1 |
| RefSeq Size | 2279 bp |
| RefSeq ORF | 876 bp |
| Locus ID | 54896 |
| UniProt ID | Q6ZP29 |
| Protein Families | Transmembrane |
| Gene Summary | Amino acid transporter that specifically mediates the pH-dependent export of the cationic amino acids arginine, histidine and lysine from lysosomes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221672 | PQLC2 (Myc-DDK-tagged)-Human PQ loop repeat containing 2 (PQLC2), transcript variant 1 |
CNY 2400.00 |
|
| RC221672L3 | Lenti-ORF clone of PQLC2 (Myc-DDK-tagged)-Human PQ loop repeat containing 2 (PQLC2), transcript variant 1 |
CNY 5890.00 |
|
| RC221672L4 | Lenti-ORF clone of PQLC2 (mGFP-tagged)-Human PQ loop repeat containing 2 (PQLC2), transcript variant 1 |
CNY 5890.00 |
|
| RG221672 | PQLC2 (tGFP-tagged) - Human PQ loop repeat containing 2 (PQLC2), transcript variant 1 |
CNY 4370.00 |
其它SLC66A1产品
